ID: 1050406112

View in Genome Browser
Species Human (GRCh38)
Location 9:5310054-5310076
Sequence TGGGTAAAAGAGGAATCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050406102_1050406112 29 Left 1050406102 9:5310002-5310024 CCAATCTTAAGGTGAGTCACATC No data
Right 1050406112 9:5310054-5310076 TGGGTAAAAGAGGAATCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050406112 Original CRISPR TGGGTAAAAGAGGAATCCAC AGG Intergenic