ID: 1050406169

View in Genome Browser
Species Human (GRCh38)
Location 9:5310463-5310485
Sequence TGATAGGAATGGAACTTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050406169_1050406172 0 Left 1050406169 9:5310463-5310485 CCATTGAAGTTCCATTCCTATCA No data
Right 1050406172 9:5310486-5310508 TTTAGAGTCTCTTCCTCGCTAGG No data
1050406169_1050406173 1 Left 1050406169 9:5310463-5310485 CCATTGAAGTTCCATTCCTATCA No data
Right 1050406173 9:5310487-5310509 TTAGAGTCTCTTCCTCGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050406169 Original CRISPR TGATAGGAATGGAACTTCAA TGG (reversed) Intergenic
No off target data available for this crispr