ID: 1050406323

View in Genome Browser
Species Human (GRCh38)
Location 9:5312182-5312204
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 20, 1: 14, 2: 7, 3: 12, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050406315_1050406323 10 Left 1050406315 9:5312149-5312171 CCTCTTGGCTCCCAAGAGGAGGG No data
Right 1050406323 9:5312182-5312204 TTTGACACACATGGCCACCTTGG 0: 20
1: 14
2: 7
3: 12
4: 160
1050406318_1050406323 -1 Left 1050406318 9:5312160-5312182 CCAAGAGGAGGGATCCCCTGATT No data
Right 1050406323 9:5312182-5312204 TTTGACACACATGGCCACCTTGG 0: 20
1: 14
2: 7
3: 12
4: 160
1050406317_1050406323 0 Left 1050406317 9:5312159-5312181 CCCAAGAGGAGGGATCCCCTGAT No data
Right 1050406323 9:5312182-5312204 TTTGACACACATGGCCACCTTGG 0: 20
1: 14
2: 7
3: 12
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050406323 Original CRISPR TTTGACACACATGGCCACCT TGG Intergenic
901383915 1:8894059-8894081 TTTGACACACATGGCCACCTTGG + Intergenic
903876254 1:26475428-26475450 TTTGACACACATGGCCACCTTGG + Exonic
905451340 1:38058771-38058793 TTGGACACACAAGGACACCTTGG - Intergenic
906246939 1:44282932-44282954 GTTGTCACTCAGGGCCACCTTGG - Intronic
907649847 1:56284801-56284823 TTTGACACAGATGACCTCCAAGG - Intergenic
909042966 1:70675808-70675830 CATGCCACACATGGCCACATGGG + Intergenic
911589391 1:99729209-99729231 TTTGACACACATGCCAACAAAGG + Intronic
912389308 1:109291104-109291126 CCGGACACACGTGGCCACCTTGG - Intergenic
913552875 1:119933980-119934002 TTTGAAACACCTGGCCTCCAAGG - Intronic
915336937 1:155149407-155149429 TTTGACACACATGGCCACCTTGG + Intergenic
918466328 1:184824903-184824925 ATTGACACACATAGCTACCTTGG + Intronic
922952544 1:229571084-229571106 TTTGACACACATGGCCACCTTGG + Intergenic
923664277 1:235985309-235985331 TCTGGCATACATGGCCACTTTGG + Intronic
923785857 1:237068475-237068497 ATTTACACAAATGGCCACGTTGG - Intronic
924040776 1:239981739-239981761 TGTGTCACAGATGTCCACCTTGG - Intergenic
924581789 1:245330180-245330202 TTTAGCACACAGGCCCACCTGGG + Intronic
1064106545 10:12505225-12505247 CTTAACACACATGGCCAACGTGG - Intronic
1065061252 10:21903362-21903384 TTTAACACATATGTCAACCTTGG + Intronic
1065317543 10:24478664-24478686 TTTGTCACACATGGTCTCCTTGG - Intronic
1065679835 10:28217795-28217817 TTTGACAAACATGACAACCCTGG - Intronic
1069809735 10:71149268-71149290 TATGACACACATGTAGACCTGGG - Intergenic
1072599796 10:96915031-96915053 TTTGATACACGTGGGCACCATGG - Intronic
1073583401 10:104687189-104687211 TTGGAAAGACAAGGCCACCTTGG - Intronic
1075018256 10:118927115-118927137 TTTTACAAACATAGACACCTGGG - Intergenic
1076373502 10:129969050-129969072 TTTGTCAAACTTGGCCGCCTTGG - Intergenic
1076373505 10:129969064-129969086 TTTGACAAACAGCGCCTCCTGGG + Intergenic
1076679360 10:132163695-132163717 ATTGACAGGCATGGCCACCAGGG - Intronic
1078693898 11:13610120-13610142 TTTGAGACACATGGCCACCTTGG - Intergenic
1080297644 11:30748990-30749012 TTTGACACCCAGGGCCACTGAGG + Intergenic
1081751556 11:45514725-45514747 TTTGACACACATAGCCACCTTGG + Intergenic
1082962185 11:58928878-58928900 TTTGAGACAGATGGCCCTCTTGG - Intronic
1084288391 11:68146463-68146485 TTTGCCCAACATGGCCTCCTGGG + Intergenic
1085074736 11:73580791-73580813 TTTGACACACATGGCCACCTTGG + Intronic
1089135055 11:116242330-116242352 ATTCACCCACATGGCCTCCTGGG - Intergenic
1091941646 12:4489511-4489533 TTTATCACACATGGACACTTGGG - Exonic
1092014928 12:5150598-5150620 TTTTAAACACATGGACACATGGG - Intergenic
1093159767 12:15732961-15732983 TTAGACAAAAATGACCACCTAGG + Intronic
1094366545 12:29688912-29688934 TTGGTCACACAGGGCCACCAGGG - Intronic
1095852129 12:46822187-46822209 TTTGACACACACGTACACATAGG + Intronic
1096406966 12:51350937-51350959 CTTGACACAGCTGGGCACCTTGG + Intergenic
1100280750 12:93116038-93116060 TTTAGCACACTTTGCCACCTGGG + Intergenic
1100613408 12:96211037-96211059 TAAGACACTCATGGCCACATGGG - Intronic
1102963632 12:117110300-117110322 TTTGACACCCATGGACACAGTGG + Intergenic
1103033472 12:117637268-117637290 TTTGACACTCATCCCCACCTCGG + Intronic
1111885987 13:94021510-94021532 TTTGACATACATGGCTAGCCAGG + Intronic
1112255013 13:97821628-97821650 TTTGACACAAAATACCACCTTGG - Intergenic
1114511289 14:23263609-23263631 TTTGACACACATGGCCACCTTGG - Intronic
1114756551 14:25266767-25266789 TCTGACACACATGGCCACCTTGG - Intergenic
1115197983 14:30822413-30822435 TATGCCACACAGGGCCACATCGG - Intergenic
1117941524 14:60971958-60971980 TTTGACACACATGGCCACCTTGG - Exonic
1118214219 14:63793201-63793223 GTTGACACACACAGCCACCTTGG + Intergenic
1119373566 14:74168859-74168881 TTTGAGACACCTGGCCATCATGG + Intronic
1119634337 14:76261828-76261850 TTTGTCACCCATCCCCACCTGGG - Intergenic
1120132416 14:80823064-80823086 GTTGACACACATGGCCACCTTGG + Intronic
1120786797 14:88545450-88545472 GGTGACACAAGTGGCCACCTGGG - Intronic
1122210931 14:100173553-100173575 CTTGCCACACACGGCCACCTGGG - Intergenic
1124445858 15:29731262-29731284 TTTGACACACATGGCCACCTTGG + Intronic
1126154836 15:45556210-45556232 TTTGATACACATGGCCACCTTGG + Intergenic
1126954678 15:53919370-53919392 TGAGGCACACATGGTCACCTAGG - Intergenic
1128507133 15:68281211-68281233 CTTGAGACACATGGCCATATAGG + Intronic
1129419937 15:75416640-75416662 TTTAACACACATGGCCACCTTGG + Intronic
1129632745 15:77279304-77279326 TTAGATACACAGGGCCTCCTTGG + Intronic
1135532675 16:23267956-23267978 CTTGTCACACACGGCCACATGGG + Intergenic
1135858295 16:26032239-26032261 TTTGACACACATGGCCACCTTGG - Intronic
1137062329 16:35802612-35802634 TTTGACACACATGGCCACCTTGG - Intergenic
1144029045 17:11303706-11303728 AGTGACACGCATGGCCAACTGGG - Intronic
1146976460 17:37117111-37117133 TTTGATACACATGGCTGCCACGG - Intronic
1147753567 17:42753233-42753255 TTTGACACACATGGCCACCTTGG - Intergenic
1149881192 17:60292760-60292782 TTTTACACACATGATCACTTTGG - Intronic
1149896830 17:60434871-60434893 TTTGATACACATGGCCACCTTGG - Intergenic
1150171824 17:63004404-63004426 TTTGACACACATAGCCACCTTGG - Intergenic
1150543128 17:66124169-66124191 TGTTCCACACATGTCCACCTTGG + Intronic
1150786653 17:68168962-68168984 TTTGACACACAGGGTCTCCAAGG + Intergenic
1153461378 18:5337235-5337257 TATCCAACACATGGCCACCTAGG + Intergenic
1153837498 18:8977094-8977116 TTGGCCACACCCGGCCACCTTGG - Intergenic
1155965677 18:32033245-32033267 TTTGACAAACACAGACACCTTGG - Intronic
1156009186 18:32476265-32476287 GTTGACACACATAGCCACCTTGG - Intergenic
1157578069 18:48757118-48757140 TTTGACACACAGAGACACCAGGG - Intronic
1158952605 18:62508699-62508721 TCTCAAACTCATGGCCACCTTGG - Intergenic
1160957485 19:1700195-1700217 TTTGACAGGCGTGGCCACCAAGG + Intergenic
1161316105 19:3618393-3618415 TTGCACACACATGGTCACCGGGG - Intronic
1162803109 19:13121875-13121897 TTTGACACACAAGGCAACTGAGG + Intronic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
927588434 2:24331553-24331575 TTTAACACACATGGCCACCTTGG + Intronic
929551453 2:42895704-42895726 TGTGACACACAATGCCACCCAGG - Intergenic
931854874 2:66292590-66292612 TTTGATACAGATGGGCTCCTAGG + Intergenic
932318681 2:70803703-70803725 TTTGATACACATGAGTACCTTGG + Intergenic
933182309 2:79241032-79241054 TTTTTCACAGATGGCCAACTTGG + Intronic
935168454 2:100590445-100590467 TTTGACACACATGACCACCTTGG - Intergenic
935338920 2:102042531-102042553 ACTGACACACATGGCCACCCTGG - Intergenic
935727847 2:106039233-106039255 TTTGAGACACACGTCCCCCTAGG - Intergenic
936492082 2:112980868-112980890 TTTGACACACATGGCCACCTTGG - Intronic
941233276 2:162938512-162938534 TTTGTAACACATGCTCACCTGGG + Intergenic
946698467 2:222385686-222385708 ATTGGGACACATGACCACCTAGG + Intergenic
946998438 2:225423396-225423418 TTTAACACAATTGGCCATCTTGG + Intronic
947486843 2:230558049-230558071 TTTGACACTCATGGCTTCCAAGG - Intergenic
1172196097 20:33092567-33092589 GTTGGCAGACATGGCCAGCTGGG - Exonic
1173385543 20:42584041-42584063 TTTCACTCACATTGACACCTTGG - Intronic
1182175279 22:28279682-28279704 TTTGACACACACATACACCTAGG + Intronic
1183324889 22:37185813-37185835 GTTGCCACCCATGGCCAGCTGGG - Intronic
1183374854 22:37457264-37457286 TTTAACAAACATGACCATCTGGG - Intergenic
1184005915 22:41708939-41708961 TTTGACACACGTGGCCACTTTGG - Intronic
1184391139 22:44204356-44204378 TTGGACGCACATGGCAGCCTTGG + Intronic
950153211 3:10704092-10704114 TATGCCACACAGGGCCACATGGG - Intronic
950778962 3:15374767-15374789 TTTGACACACATGGCCACCTTGG - Intergenic
953192217 3:40698771-40698793 TTTGACACAGATGGTCACCTTGG - Intergenic
955694981 3:61626801-61626823 CATGGCCCACATGGCCACCTAGG + Intronic
956657257 3:71564594-71564616 ACTGACACACATGACCACATTGG + Intronic
960297818 3:115966052-115966074 TTTGCCCCACATGGCAAACTGGG - Intronic
961749616 3:129087503-129087525 GTTGAGGCACGTGGCCACCTGGG + Intergenic
962879657 3:139564352-139564374 TTTACCATACAAGGCCACCTTGG + Intronic
963398894 3:144771472-144771494 TTTGACACACATGGGCATGAAGG - Intergenic
968433096 4:570348-570370 ATGCACACACATGGCCTCCTGGG - Intergenic
970989043 4:22191669-22191691 TTTGTAATACATGCCCACCTGGG + Intergenic
973870153 4:55158069-55158091 TATGACACAGATGCCTACCTGGG - Intergenic
977657347 4:99537058-99537080 TTTGACCCAGATGGCCTTCTTGG + Intronic
979572703 4:122248388-122248410 TTTTACAGAAATGTCCACCTTGG - Intronic
980639665 4:135560906-135560928 TTCGACGCACTTGGCCTCCTCGG + Intergenic
982049035 4:151480890-151480912 TTTGACACACATACACACATAGG + Intronic
984438095 4:179729143-179729165 CGTGCCACACATGGCCACTTGGG + Intergenic
985656746 5:1135847-1135869 TTTGACAAACAGTGCCAGCTTGG + Intergenic
988708618 5:33751377-33751399 TGTGACTCACATGTCCTCCTGGG - Intronic
990204733 5:53416377-53416399 GTTGACACTCAGGGCAACCTTGG - Intergenic
992101367 5:73410702-73410724 TTTGACACACATGGCCACCTTGG + Intergenic
992381455 5:76241721-76241743 TTTGACACACATGGCCACCTTGG - Intronic
995819840 5:116217731-116217753 TTTGACACATATGGCCACCTTGG - Intronic
996817032 5:127585697-127585719 TTTGACAAACAGGGCCACCCTGG + Intergenic
998927302 5:147140793-147140815 TTTGAGACAGATGGCCCTCTAGG + Intergenic
999009955 5:148025340-148025362 TTTGTTACACATGGCCAAGTTGG + Intergenic
1001237196 5:170040133-170040155 TAAGACACACATGGTCTCCTTGG + Intronic
1001434195 5:171686746-171686768 TTTGACAAACATGGAAAGCTGGG + Intergenic
1002261161 5:177994971-177994993 CTGGACACACACGACCACCTGGG + Intronic
1005250956 6:23945623-23945645 TTTGGTAGACAGGGCCACCTGGG + Intergenic
1005482516 6:26268254-26268276 CTTGACAAACCTGGCCAACTTGG - Intergenic
1007708573 6:43806615-43806637 CTTCACACACAAGGACACCTGGG - Intergenic
1008202836 6:48613731-48613753 TTTGCCACATCTGGCCACCAGGG + Intergenic
1010727702 6:79354157-79354179 TTTGACACACATGGCCACCTTGG - Intergenic
1010918756 6:81654027-81654049 TATGAAATACATTGCCACCTTGG - Intronic
1011127325 6:84021151-84021173 TTTAAAACACATGTCTACCTAGG - Intergenic
1013368267 6:109450451-109450473 TTTGCCACCCATGGCAAGCTCGG - Exonic
1014434772 6:121409088-121409110 TTTGACACACATGGCCAGCTTGG + Intergenic
1016438323 6:144059921-144059943 TTTCAGACCCTTGGCCACCTGGG - Intronic
1017752554 6:157501957-157501979 TTGACCACACATGGCCACCGTGG + Intronic
1023625787 7:42113898-42113920 TTTGATACACATGTCCACCTTGG + Intronic
1024053772 7:45646579-45646601 TTTGAAACATTTGGACACCTGGG + Intronic
1024284101 7:47742169-47742191 GTTGACCCACATGACCTCCTCGG - Intronic
1030317075 7:108126981-108127003 TTTTATACACATTGACACCTGGG - Intronic
1030641385 7:112010461-112010483 TGTGACACACATAGCCACCTGGG - Intronic
1031453954 7:121956776-121956798 TTTGACATACATGGCCACCTTGG - Intronic
1031894236 7:127329698-127329720 TGTGACACACATGTCCTCTTTGG + Intergenic
1034392678 7:150799601-150799623 TTTCACCCACCTGGCCTCCTTGG + Intronic
1034576720 7:152006135-152006157 TTGGACACACATGCCTCCCTGGG - Intronic
1035687855 8:1538793-1538815 ATTCACACACATGTCCACCCGGG - Intronic
1037248747 8:16867742-16867764 ATTGATACAAATGTCCACCTAGG + Intergenic
1037584371 8:20266520-20266542 TTTGAGACAACTGGTCACCTGGG + Intronic
1038654719 8:29438725-29438747 TGTACCACACAGGGCCACCTGGG - Intergenic
1039839261 8:41281773-41281795 TTTCATATACATGGCCAACTGGG + Intronic
1042781130 8:72492116-72492138 TTTGAGACACATAGGCACCAAGG + Intergenic
1049065139 8:140307454-140307476 TTCAACACACAAGGTCACCTGGG + Intronic
1050010291 9:1179189-1179211 CTTGAAACACATGGTCACCTGGG - Intergenic
1050406323 9:5312182-5312204 TTTGACACACATGGCCACCTTGG + Intergenic
1050445353 9:5716168-5716190 TTTAACACACACGCACACCTGGG + Intronic
1051295362 9:15589184-15589206 ATTGACACACATAGCCACCTTGG + Intronic
1052430182 9:28356309-28356331 TTTGAAAGACATGACCTCCTAGG + Intronic
1052627485 9:30995712-30995734 GTTCACACTCATGGTCACCTAGG - Intergenic
1052742600 9:32407781-32407803 TTTGACACACCTGGTTTCCTGGG - Intronic
1053538094 9:38946107-38946129 CATGCCACACAGGGCCACCTGGG + Intergenic
1054628040 9:67417814-67417836 CATGCCACACAGGGCCACCTGGG - Intergenic
1056180665 9:84079297-84079319 TTTGACACACATGGCCACCTTGG + Intergenic
1057247808 9:93472511-93472533 TTGGACACACAAGGCCAGTTTGG + Intronic
1058683007 9:107456594-107456616 TTTGACACACTTGGCCACCTTGG - Intergenic
1058982096 9:110179488-110179510 ACTGACACACATGGCCACAGAGG + Intergenic
1061023264 9:128030740-128030762 TTTGACATATGTGACCACCTGGG + Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1186305592 X:8253620-8253642 TTTGACACAGAAGGCCACATTGG + Intergenic
1187116457 X:16357062-16357084 TTTGCCCCATATGGCCATCTAGG - Intergenic
1187938005 X:24354518-24354540 TTTGACACACATGGCCACCTTGG + Intergenic
1188362164 X:29268445-29268467 TTTGACAGAAAAGGCCACCCCGG - Intronic
1189249174 X:39586787-39586809 TGGGACAGACATGGCAACCTTGG - Intergenic
1190258758 X:48785156-48785178 TCTGACACACATGCACACGTGGG - Intergenic
1192779654 X:74281338-74281360 TTTGTCTCACATGGCTTCCTTGG + Intergenic
1199212153 X:145225364-145225386 TTAGAAACACATGGCCATATGGG - Intergenic
1199999595 X:153051854-153051876 TTTGACACACATGGCCACCTTGG - Intergenic
1201261080 Y:12159546-12159568 TCTGACACCCATGGCCTCCATGG + Intergenic