ID: 1050406559

View in Genome Browser
Species Human (GRCh38)
Location 9:5314620-5314642
Sequence GTACCCTGCTTTCCTGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050406555_1050406559 4 Left 1050406555 9:5314593-5314615 CCTCACCCTACAGGTTGAATAAT No data
Right 1050406559 9:5314620-5314642 GTACCCTGCTTTCCTGGAACTGG No data
1050406556_1050406559 -1 Left 1050406556 9:5314598-5314620 CCCTACAGGTTGAATAATTGTAG No data
Right 1050406559 9:5314620-5314642 GTACCCTGCTTTCCTGGAACTGG No data
1050406557_1050406559 -2 Left 1050406557 9:5314599-5314621 CCTACAGGTTGAATAATTGTAGT No data
Right 1050406559 9:5314620-5314642 GTACCCTGCTTTCCTGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050406559 Original CRISPR GTACCCTGCTTTCCTGGAAC TGG Intergenic
No off target data available for this crispr