ID: 1050407187

View in Genome Browser
Species Human (GRCh38)
Location 9:5321983-5322005
Sequence CAGGAAGGTATAGAATTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050407182_1050407187 9 Left 1050407182 9:5321951-5321973 CCTCCTTATTTCCTTTTATTTCA No data
Right 1050407187 9:5321983-5322005 CAGGAAGGTATAGAATTTGAAGG No data
1050407183_1050407187 6 Left 1050407183 9:5321954-5321976 CCTTATTTCCTTTTATTTCAAAA No data
Right 1050407187 9:5321983-5322005 CAGGAAGGTATAGAATTTGAAGG No data
1050407184_1050407187 -2 Left 1050407184 9:5321962-5321984 CCTTTTATTTCAAAACTAGAACA No data
Right 1050407187 9:5321983-5322005 CAGGAAGGTATAGAATTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050407187 Original CRISPR CAGGAAGGTATAGAATTTGA AGG Intergenic