ID: 1050418459

View in Genome Browser
Species Human (GRCh38)
Location 9:5438006-5438028
Sequence CAGTGTTACCAGAGGTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 236}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050418450_1050418459 3 Left 1050418450 9:5437980-5438002 CCGGGTGTGTCCTTCCGGGCCAG 0: 1
1: 0
2: 0
3: 12
4: 130
Right 1050418459 9:5438006-5438028 CAGTGTTACCAGAGGTGGGAGGG 0: 1
1: 0
2: 1
3: 22
4: 236
1050418446_1050418459 13 Left 1050418446 9:5437970-5437992 CCGCCAGAAGCCGGGTGTGTCCT 0: 1
1: 0
2: 1
3: 14
4: 115
Right 1050418459 9:5438006-5438028 CAGTGTTACCAGAGGTGGGAGGG 0: 1
1: 0
2: 1
3: 22
4: 236
1050418447_1050418459 10 Left 1050418447 9:5437973-5437995 CCAGAAGCCGGGTGTGTCCTTCC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1050418459 9:5438006-5438028 CAGTGTTACCAGAGGTGGGAGGG 0: 1
1: 0
2: 1
3: 22
4: 236
1050418452_1050418459 -7 Left 1050418452 9:5437990-5438012 CCTTCCGGGCCAGGCTCAGTGTT 0: 1
1: 0
2: 0
3: 15
4: 212
Right 1050418459 9:5438006-5438028 CAGTGTTACCAGAGGTGGGAGGG 0: 1
1: 0
2: 1
3: 22
4: 236
1050418443_1050418459 22 Left 1050418443 9:5437961-5437983 CCGGCACTTCCGCCAGAAGCCGG 0: 1
1: 0
2: 0
3: 12
4: 89
Right 1050418459 9:5438006-5438028 CAGTGTTACCAGAGGTGGGAGGG 0: 1
1: 0
2: 1
3: 22
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050418459 Original CRISPR CAGTGTTACCAGAGGTGGGA GGG Intergenic
900162995 1:1233236-1233258 CAGTGCTGCCAGAGAAGGGAGGG + Exonic
900802340 1:4745260-4745282 CGGTGCTGGCAGAGGTGGGAGGG - Intronic
901989410 1:13100656-13100678 CAGTGTGGCCAGACCTGGGAAGG + Intergenic
901992403 1:13126108-13126130 CAGTGTGGCCAGACCTGGGAAGG - Intergenic
902759457 1:18571735-18571757 CACTGTGACCAGAGGTGGGCTGG - Intergenic
903015630 1:20359924-20359946 CAGAGTTACCAGTGGGGCGAGGG - Intergenic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
905230861 1:36514302-36514324 AGGTGCTACCTGAGGTGGGAGGG + Intergenic
905645587 1:39623089-39623111 CAGTGGAGCCAGAGCTGGGAAGG - Intergenic
905997151 1:42391148-42391170 GAGTGGTAGCTGAGGTGGGATGG + Intronic
906102962 1:43274776-43274798 GAGTGTTGCCAGTGGAGGGAGGG + Intergenic
906537362 1:46558904-46558926 CAGATTTCCCAGAGCTGGGACGG + Intronic
907219438 1:52895268-52895290 CCTTGGTACCAGAGGAGGGAGGG + Intergenic
907809442 1:57853817-57853839 CTGTGTTACAAGAGGTGAGAAGG + Intronic
909144468 1:71912306-71912328 CAGAGTTATGAGATGTGGGAAGG - Intronic
909463683 1:75948309-75948331 GATAGATACCAGAGGTGGGAAGG + Intergenic
910552982 1:88497982-88498004 CACTGTTACCTTGGGTGGGATGG + Intergenic
911111605 1:94193810-94193832 AAGTGTTACCAGAGGAAAGATGG + Intronic
918099918 1:181364466-181364488 CACTGTGATCAGAGGTGGGATGG + Intergenic
919527128 1:198667243-198667265 CATTGCTGTCAGAGGTGGGAAGG + Intronic
921099543 1:211916458-211916480 CAGTTTTGCCTGAGGTGGGTTGG - Intergenic
921508693 1:216005997-216006019 CAGTGTGACCGGAGATGTGATGG - Intronic
922329341 1:224560407-224560429 GAGTGGTACCAGGGGTTGGAGGG - Intronic
922405199 1:225305485-225305507 CAGTGGTACCTGAGGAGGCACGG + Intronic
922982407 1:229838758-229838780 CATTGTTTCCAGAGGGGCGAGGG - Intergenic
923678567 1:236100853-236100875 CAGCCCTCCCAGAGGTGGGACGG - Intergenic
924153762 1:241154807-241154829 CAGTGATGGCAGACGTGGGAGGG + Intronic
924921233 1:248631387-248631409 CAGTTTTACCAGCTGTGAGATGG - Intergenic
1064424767 10:15220935-15220957 CCGTGTTACCTGGGATGGGAGGG + Exonic
1065852772 10:29804715-29804737 CAGCGCTACCACAGGTGGGTGGG - Intergenic
1069551424 10:69367072-69367094 AAGTGTTGCAGGAGGTGGGAGGG + Intronic
1071295735 10:84217948-84217970 AAGTGTGATCAGAGCTGGGAAGG + Intronic
1073891023 10:108101305-108101327 CAATGATACAAGGGGTGGGAGGG + Intergenic
1076336762 10:129712142-129712164 CAGGGTTTCCATGGGTGGGAGGG - Intronic
1076427659 10:130379200-130379222 CAGTGTGAGCTGAGGAGGGAAGG - Intergenic
1078434035 11:11309868-11309890 CAGGGTGAGGAGAGGTGGGATGG - Intronic
1078673642 11:13388866-13388888 CACTGTTGCCAGAAGGGGGATGG + Exonic
1078758350 11:14232541-14232563 CAGAGTTGCCAGAGTGGGGAGGG - Intronic
1078786330 11:14498021-14498043 GATGGTTATCAGAGGTGGGAAGG + Intronic
1079657514 11:23001262-23001284 CTGTGATACCAGTGGTGGGGAGG - Intergenic
1080272606 11:30466854-30466876 CGTTGTTACCAGAGTTGGCATGG - Intronic
1081584771 11:44376748-44376770 CAGTGTGACCACACGGGGGATGG + Intergenic
1084108496 11:66997233-66997255 CAGTGGTGCCAGAGGTGGCCTGG + Intergenic
1085990432 11:81836360-81836382 GATGGTTACCAGAGGTGGGAAGG - Intergenic
1086928777 11:92669656-92669678 CAGTATATCCAGAGGTGGGGTGG + Intronic
1087005817 11:93470219-93470241 GGGGGCTACCAGAGGTGGGAAGG - Intergenic
1087738450 11:101860510-101860532 AATTGGTACCAGAGGTGGTATGG - Intronic
1089708503 11:120298377-120298399 CAGTGTTACCTGACATGGGCTGG - Exonic
1090216876 11:124975166-124975188 CAGTGTTTCCAGATGATGGAAGG + Exonic
1091831664 12:3554610-3554632 CAGAGTTCCAAAAGGTGGGAAGG + Intronic
1092454770 12:8633363-8633385 CTTTGTTACCAGAGGAGGAAAGG + Intergenic
1093207817 12:16271469-16271491 CAGTCTTACCAAAGGTAGAAGGG - Intronic
1095384267 12:41631693-41631715 CTGTGTAAGCTGAGGTGGGATGG + Intergenic
1095620160 12:44243789-44243811 GATTGTTGCCAGAGGTGGGAGGG - Intronic
1097008130 12:55933347-55933369 CAGGGAAACCAGAGGAGGGAAGG + Intronic
1097450688 12:59733896-59733918 CAGGATTACCAGCTGTGGGAAGG - Intronic
1097761759 12:63474283-63474305 CAGAGATTCCAGAGGGGGGAGGG - Intergenic
1098224095 12:68303349-68303371 CAATGATACCAGAGCTGGCAAGG + Intronic
1100406163 12:94274475-94274497 CTTTGTTAGCAGAGGAGGGATGG + Intronic
1101364365 12:104058070-104058092 CAGAGTTTCCAGAGCTGGGATGG + Intronic
1103075761 12:117981281-117981303 CAGTCACAGCAGAGGTGGGAGGG - Intergenic
1106867038 13:33976393-33976415 GGGGGTTATCAGAGGTGGGAAGG + Intergenic
1107582875 13:41810606-41810628 GATGGTTACCAGAGGTGGGAAGG + Intronic
1110324549 13:74199015-74199037 CAGTGAGAGCCGAGGTGGGATGG + Intergenic
1111243758 13:85508452-85508474 CAGGACTACCAGCGGTGGGAAGG + Intergenic
1111514404 13:89309377-89309399 CAGTGTTACTAGAGCTGTGGTGG - Intergenic
1112708396 13:102098953-102098975 CAGTTTTCCTAGAAGTGGGAAGG + Intronic
1112955285 13:105050578-105050600 CAGTATTACCAGGGCTGGAATGG + Intergenic
1113808196 13:113122125-113122147 CAGTGTGGCCAGTGGTGGGCAGG + Intergenic
1115750367 14:36483345-36483367 CAGTCTTACCAGAGCTGGCCTGG + Intronic
1116248754 14:42454966-42454988 TATTGTTACCAGAAGTGGGGTGG + Intergenic
1116862529 14:50006160-50006182 CAGTGTTACAAGAGTGGGGTTGG + Exonic
1117601880 14:57384646-57384668 CAGTTTTGCGAGAGGTGGGGAGG + Intergenic
1117612903 14:57502785-57502807 CAGTGTGCCCTGAAGTGGGAAGG + Intergenic
1118606797 14:67510123-67510145 CAGTGTTTCCAGCTGTGAGATGG + Intronic
1121089339 14:91170385-91170407 CAGTGGTCCCAGAGGTGAGTGGG - Intronic
1121819077 14:96951409-96951431 GAGTGTTACCAGCAGAGGGAAGG + Intergenic
1122053953 14:99079559-99079581 CCGTGTCCCCAGAGGTGTGACGG - Intergenic
1122122584 14:99562294-99562316 CAGGGGTGCCAGAGGAGGGAGGG - Intronic
1122189290 14:100027412-100027434 GATGGTTATCAGAGGTGGGAAGG - Intronic
1122912833 14:104841685-104841707 TAGTGCTCCCAGAGGTGTGAGGG - Intergenic
1124006154 15:25797131-25797153 GGGGGTTACCAGAGGTTGGAAGG - Intronic
1125515025 15:40313915-40313937 CAGTGTTACCAGAGCTTTGCAGG - Intergenic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1127310080 15:57744690-57744712 CAGTGTTACAGGAGATGTGAGGG - Intronic
1127637817 15:60888279-60888301 CAGTGTCCCCTGAGGTGGGGTGG - Intronic
1129181951 15:73883209-73883231 CAGAGTGACCCGGGGTGGGACGG + Intronic
1129457361 15:75683031-75683053 CTGTGTTCCCAGATGTGGGAGGG - Exonic
1130045430 15:80440594-80440616 CACTGTTAGCTGAGGTGGGAGGG + Intronic
1130274466 15:82469262-82469284 CTGTGTCCCCAGATGTGGGAGGG + Intergenic
1130466813 15:84196636-84196658 CTGTGTCCCCAGACGTGGGAGGG + Intergenic
1130497451 15:84476900-84476922 CTGTGTCCCCAGACGTGGGAGGG - Intergenic
1130589108 15:85201229-85201251 CTGTGTCCCCAGATGTGGGAGGG + Intergenic
1131902143 15:97099530-97099552 GTGTGTTAACAGAAGTGGGAGGG - Intergenic
1133408696 16:5549843-5549865 CAGTGTCATCTGAGATGGGAGGG + Intergenic
1133431379 16:5739989-5740011 CAGTGTGGCCAGCAGTGGGAGGG + Intergenic
1138523941 16:57590984-57591006 CAGGGATATCTGAGGTGGGAGGG + Intronic
1141677143 16:85523892-85523914 CAGGCTGAGCAGAGGTGGGAGGG + Intergenic
1141981876 16:87555756-87555778 AAGTGTAACGAGAGGAGGGAGGG - Intergenic
1143316688 17:6038264-6038286 CAGTGTGGCCAGAGCGGGGAGGG + Intronic
1143962377 17:10731323-10731345 CCGTGTTTGCAGAGGTGGGGTGG + Intergenic
1148676019 17:49445575-49445597 GAATGTTCTCAGAGGTGGGAAGG - Intronic
1148778513 17:50109158-50109180 CAGGGGTCCCAGAGCTGGGAGGG - Intronic
1148939274 17:51193972-51193994 CAGTGTTTCTAGAGAGGGGAGGG - Intronic
1150024240 17:61655156-61655178 CAATGTTACAAGTGGTGGGAGGG + Intergenic
1150135268 17:62691962-62691984 CACAGTAACCAGAGGTAGGATGG + Intronic
1151392948 17:73800083-73800105 CAGTGGTTTCAGAGGTGGGGAGG + Intergenic
1151625759 17:75274545-75274567 CAGTTTGGCCAGAGGTGGGAAGG - Intronic
1151820345 17:76493586-76493608 CAGAGTTAGCAGAGGGGAGAGGG + Intronic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1153146790 18:2042313-2042335 TATTGGTAACAGAGGTGGGAGGG + Intergenic
1153757625 18:8300041-8300063 CAATGTTGTCAGAGGCGGGATGG + Intronic
1154381126 18:13850836-13850858 TGGGGTTACTAGAGGTGGGAGGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155817685 18:30334651-30334673 CAGTGTTACCAGTGATGGGTCGG + Intergenic
1156485927 18:37465601-37465623 CTGTGTGCCCAGAGCTGGGATGG + Intronic
1160436922 18:78858931-78858953 CATTGGTACCAGCAGTGGGAGGG + Intergenic
1162265742 19:9572496-9572518 CAGAGTTTCCAGGGCTGGGATGG - Intronic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1166423637 19:42656986-42657008 CAGAGTCACAGGAGGTGGGATGG - Intronic
1166455053 19:42933854-42933876 CAGAGTTACATGAGGTGGGGTGG + Intronic
1166464847 19:43023139-43023161 CAGAGTTACATGAGGTGGGGTGG + Intronic
1166484606 19:43202355-43202377 CAGAGTTACATGAGGTGGGGTGG + Intronic
1166491729 19:43266236-43266258 CAGAGTTACATGAGGTGGGGTGG + Intronic
925365866 2:3311824-3311846 CTGGGGCACCAGAGGTGGGAGGG + Intronic
927338490 2:21952845-21952867 CAGTGTAACATGAGCTGGGAGGG + Intergenic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
931460552 2:62446891-62446913 AAGTTTCACCAGAGGTGAGAAGG - Intergenic
931530014 2:63203466-63203488 GATGGTTACCAGAGCTGGGAAGG - Intronic
933909987 2:86930811-86930833 CAGTGGCAGCAGAGGTGGCAGGG - Intronic
934022738 2:87972577-87972599 CAGTGGCAGCAGAGGTGGCAGGG + Intergenic
935250353 2:101255056-101255078 CAGATTTGCCATAGGTGGGATGG + Intronic
935619005 2:105112621-105112643 CAGTGTTTCCTGGGGTGAGAGGG + Intergenic
939473108 2:142650526-142650548 CATTATTTCCAGAGGTGAGAAGG + Intergenic
939529277 2:143337002-143337024 CAGTGTTTCAGGAGGTGGAAGGG + Intronic
941423531 2:165314487-165314509 CAGTATCACCAGAGGTGGTAAGG + Intronic
943040759 2:182802286-182802308 GAGTGATGGCAGAGGTGGGATGG + Intergenic
945344109 2:208692647-208692669 CAGTGTTTCTAGAGTTGGGAAGG - Intronic
945969637 2:216223085-216223107 GTGTGTTTCCAGAGGTGGCAGGG + Intergenic
947067097 2:226239971-226239993 CATTGTTACCACTGGTGGGAGGG + Intergenic
948078393 2:235185130-235185152 CAGTTTTGCCAGAGGGGAGAAGG - Intergenic
948546675 2:238736866-238736888 CAGTGTTATAAGGGATGGGAAGG - Intergenic
948678247 2:239611735-239611757 CAGTGTGACTGGAGGTGTGATGG - Intergenic
948770741 2:240250254-240250276 CAGTGTCTCAGGAGGTGGGAAGG - Intergenic
949042127 2:241854298-241854320 TGGTGTTCCCAGAGGTGGCAGGG + Intronic
1172088026 20:32404175-32404197 GATCGTTACCAGAGCTGGGAAGG - Intronic
1175041777 20:56058971-56058993 CTGTGTCACCACAGTTGGGATGG + Intergenic
1175507272 20:59494827-59494849 CAGAGTTCCCAGAGGAGGAAGGG - Intergenic
1175695285 20:61098766-61098788 CAGTGTAGCCAGACCTGGGAGGG - Intergenic
1177364592 21:20117561-20117583 CAGTGGTGCCAGAAGTGGGGAGG - Intergenic
1178950400 21:36980863-36980885 CCGTGTGGCCAGAGGTGGCAGGG - Intronic
1178976594 21:37226249-37226271 CAGTGTGAGGAGGGGTGGGAAGG + Intronic
1179952244 21:44715021-44715043 CAGAGTTAGCAGACCTGGGATGG - Intergenic
1181331389 22:22094848-22094870 CATGGTTACCAGAGGTTGGGGGG + Intergenic
1181793924 22:25290038-25290060 CAGTAGGAACAGAGGTGGGAGGG + Intergenic
1181815236 22:25431823-25431845 CAGGGCCACCAGAGCTGGGAAGG - Intergenic
1181833920 22:25586581-25586603 CAGTAGGAACAGAGGTGGGAGGG + Intronic
1181990587 22:26833820-26833842 CAGGGTGGCAAGAGGTGGGAAGG + Intergenic
1182491384 22:30674511-30674533 CAGTGGTACCTTAGATGGGAAGG + Intergenic
1182564528 22:31187407-31187429 CATTGGTAGCAGAGCTGGGATGG - Intronic
1184681825 22:46076413-46076435 CAGTGTTCCCTGGGCTGGGACGG + Intronic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
949929736 3:9069354-9069376 CAGTGTGCCCAGGGCTGGGAAGG + Intronic
950179575 3:10901586-10901608 CAGTGGGAACAGTGGTGGGAAGG - Intronic
950542583 3:13621123-13621145 CAGGGCTTCCAGAGGAGGGAGGG - Intronic
950722568 3:14894119-14894141 GGTGGTTACCAGAGGTGGGAAGG - Intronic
951380258 3:21975389-21975411 CGTGGTTACCAGAGGTTGGAAGG + Intronic
954437822 3:50505194-50505216 CATTGTGTCCAGAGGTGGCAGGG - Intergenic
955771639 3:62390542-62390564 AAGTGGTAACAGAGGTGGGCAGG - Intergenic
957516217 3:81255424-81255446 CAATGATACCAGAGGTGGAATGG - Intergenic
958502228 3:94927232-94927254 CAATGATACAAGAGATGGGAGGG + Intergenic
961151226 3:124639951-124639973 CATTGCTACCACATGTGGGAAGG - Intronic
962817447 3:139014979-139015001 GCGCTTTACCAGAGGTGGGAGGG - Intronic
964705498 3:159614625-159614647 CAGTCTTACCAGAATTGAGAAGG - Intronic
965506546 3:169521547-169521569 TAGTGTCTCCAGAGGTGTGAAGG + Intronic
966808047 3:183821470-183821492 CACCGTCACCAGAGCTGGGAGGG + Intronic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
967637105 3:191815491-191815513 GATGGTTACCAGAGGTGGAAAGG + Intergenic
967702365 3:192608129-192608151 GATGGTTACCAGAGTTGGGAAGG + Intronic
971047338 4:22819745-22819767 CAGTGTAAGCAAAGGTGGGGTGG + Intergenic
971562382 4:28096459-28096481 CAGTGTTACACGAATTGGGAAGG - Intergenic
972195499 4:36648953-36648975 CAGTGTTCCCAATGTTGGGAGGG + Intergenic
973739148 4:53902266-53902288 CCGAGGAACCAGAGGTGGGAGGG - Intronic
974109844 4:57512548-57512570 CAGAGTGCCCAGAGGTGGGGTGG - Intergenic
974712694 4:65621308-65621330 CACTGTGGCCAGAAGTGGGATGG + Intronic
975888853 4:79000237-79000259 GAGTATTACCAGAGATGAGAAGG - Intergenic
979812799 4:125060676-125060698 CAGTCTTACCAGGGCAGGGAAGG - Intergenic
980015608 4:127646625-127646647 CAAGGTTACCAGAGGTGAGGGGG - Intronic
982925886 4:161336433-161336455 CAAAGTAACCAGAGGTGAGAAGG + Intergenic
983471678 4:168164086-168164108 CAGTGTTTTGAGAGGTGGCAGGG - Intronic
984059382 4:174973387-174973409 CAGAGTTACCAAAGTTGGTAGGG - Intronic
985829216 5:2215618-2215640 CTGTGTTGGCAGAGGTGGGCAGG + Intergenic
987458775 5:18180748-18180770 CAGAGTAAACAGAGGTGGTAAGG - Intergenic
989402118 5:41018925-41018947 CAGATTTTCCAGAGGTGGAAGGG + Exonic
992186369 5:74248577-74248599 CAGTGTCACCTGATGTGGGCTGG + Intergenic
993002822 5:82399403-82399425 CAGTGTTGCTAGAGGAGTGATGG + Intergenic
993894247 5:93512166-93512188 CAGTGGGACAAGATGTGGGATGG + Intergenic
995289016 5:110428146-110428168 GATTGTTACCAGGGCTGGGAAGG - Intronic
995803233 5:116022736-116022758 CAGTGATGGCAAAGGTGGGATGG - Intronic
996816591 5:127580888-127580910 GATGGTTACCAGAGGTGAGAGGG + Intergenic
998821574 5:146062485-146062507 CAGGCTTTCCGGAGGTGGGATGG - Exonic
999852859 5:155561658-155561680 CAGTGAGTTCAGAGGTGGGATGG - Intergenic
1001410475 5:171507988-171508010 GAGCGTTTCCAGAGCTGGGATGG + Intergenic
1002888561 6:1316026-1316048 CCCTGGAACCAGAGGTGGGAAGG - Intergenic
1002970628 6:2014415-2014437 CAATGTTATAAGAGGTGGAAGGG + Intronic
1004849089 6:19677575-19677597 CTTTGTTACCACGGGTGGGAAGG - Intergenic
1007390517 6:41547340-41547362 CAGACTTTCCAGAGCTGGGAAGG + Intronic
1010743185 6:79531234-79531256 CAGTTTTAGCAGAGTTGAGAGGG - Intronic
1011118581 6:83924651-83924673 CAGTTGTACCAGAGTTTGGAAGG + Intronic
1011820018 6:91242406-91242428 CTGTGCTACCACAGGTTGGAAGG - Intergenic
1011901234 6:92301327-92301349 CACTGCTGCCAGTGGTGGGATGG - Intergenic
1013066265 6:106686996-106687018 AAATGTCACCAGTGGTGGGACGG - Intergenic
1014296638 6:119626608-119626630 CAGTGGTTCCAGGGGTGGTAGGG + Intergenic
1015281010 6:131434011-131434033 CAGCATTGTCAGAGGTGGGAGGG - Intergenic
1015419918 6:132995647-132995669 CAGGGTTACCAGAGTGGGGCTGG - Intergenic
1017054720 6:150426481-150426503 CAGTGTTCTCAGAGGAAGGAGGG + Intergenic
1018546197 6:164939024-164939046 CAATGTTATAAGAGGTGGGAGGG + Intergenic
1021232609 7:18103979-18104001 GAGTGTTCCCTGAGATGGGATGG - Intronic
1022603018 7:31779614-31779636 CATGGTTATGAGAGGTGGGATGG - Intronic
1022783904 7:33616295-33616317 CAATGATACAAGAGATGGGATGG + Intergenic
1023889051 7:44379919-44379941 TAGTTTTAGCAGAGGTGTGAAGG + Exonic
1024519610 7:50293369-50293391 GAGTGTTACCAGAGATGGTTTGG - Intergenic
1024674430 7:51625408-51625430 CGTGGTTACCAGAGGTGGGGAGG - Intergenic
1024676159 7:51639516-51639538 CACAGTTGCCAGGGGTGGGAAGG - Intergenic
1024922091 7:54568771-54568793 CAGTGTTCCCAGCCGTGGGGTGG + Intronic
1025109629 7:56203205-56203227 CAGTGTGGCTATAGGTGGGATGG + Intergenic
1029504067 7:100951512-100951534 GGGTGTGACCAGAGGAGGGAAGG + Intronic
1029949470 7:104567861-104567883 CAGTTATAGCAGAGGTGGGAGGG - Intronic
1033590621 7:142805336-142805358 CAGTGTTACCTGAGGAAGAATGG - Intergenic
1033955019 7:146836393-146836415 CAGTTTTAACAGAGGTAGTATGG + Intronic
1035731196 8:1854515-1854537 CAGTGTTTGCAGAGGATGGAGGG + Intronic
1036074110 8:5475673-5475695 CAGTGTAACAGGAGGTGGGTAGG - Intergenic
1040469292 8:47723881-47723903 GAGTGTTACAAGGGATGGGAAGG - Intronic
1043031763 8:75142975-75142997 TAGTGTTTCCAAAGGTGGTATGG - Intergenic
1043448337 8:80341023-80341045 CAGAGTAACCAGAGATGTGAAGG + Intergenic
1044375512 8:91465462-91465484 GTGTGTTACCAGAAGTGGGAAGG + Intergenic
1045962042 8:107979792-107979814 CAGTGGTACTTGAGGTGGGGAGG - Intronic
1047745195 8:127839811-127839833 CAGTGTTGCCAGGGCTGGGGAGG + Intergenic
1050418459 9:5438006-5438028 CAGTGTTACCAGAGGTGGGAGGG + Intergenic
1050840684 9:10144959-10144981 CAGTTTTTCCAGAGGTGGGCCGG - Intronic
1052712129 9:32069812-32069834 CTGTGTTACCAGAGGTGGAAAGG - Intergenic
1055144155 9:72912671-72912693 CAGTGGGACCAGAACTGGGAAGG - Intronic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1058557887 9:106189590-106189612 GATGGTTACCAGAGATGGGAAGG - Intergenic
1059326418 9:113506541-113506563 CAGTGTGCCCAGGGGTGGGGAGG - Intronic
1061457956 9:130712903-130712925 CAGTGGGACCAGAGCCGGGAGGG + Intergenic
1061506502 9:131034658-131034680 GAGCCTCACCAGAGGTGGGAGGG - Intronic
1061672615 9:132197598-132197620 CACTGTCACCAGGTGTGGGAGGG + Intronic
1062511352 9:136907905-136907927 CAGGGCTCCCACAGGTGGGAGGG - Intronic
1187605936 X:20883343-20883365 GATGGCTACCAGAGGTGGGAAGG + Intergenic
1190189308 X:48263178-48263200 CAGTGTAACCAGAATTGGTATGG + Intronic
1190326965 X:49212490-49212512 CAGTGAGACCAGAGGTGTGTTGG + Intronic
1191675340 X:63786674-63786696 CTGGGTTACCAGACTTGGGAGGG - Intergenic
1194529244 X:95024435-95024457 GACAGTTACCAGGGGTGGGAGGG - Intergenic
1195002266 X:100653276-100653298 TAGTGTTATCAGAAGTAGGAAGG - Intronic
1195406561 X:104520838-104520860 GATGGTTACCAGAGGTGGGAAGG - Intergenic
1195613552 X:106895178-106895200 CAGGGCTACCAGGGGTGAGAGGG - Intronic
1198340237 X:135707010-135707032 CAGAGCTACCAGAGTTGTGAGGG - Intergenic
1198343719 X:135739742-135739764 CAGAGCTACCAGAGTTGTGAGGG - Intergenic
1199458989 X:148061794-148061816 GATGGTTACCAGAGGTGGGAAGG - Intergenic