ID: 1050423430

View in Genome Browser
Species Human (GRCh38)
Location 9:5490428-5490450
Sequence GTGGGAGGGCAAATATTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050423430_1050423439 14 Left 1050423430 9:5490428-5490450 CCTCCAAATATTTGCCCTCCCAC No data
Right 1050423439 9:5490465-5490487 CTAGTTGCCCTGCCATAGCTAGG No data
1050423430_1050423432 -10 Left 1050423430 9:5490428-5490450 CCTCCAAATATTTGCCCTCCCAC No data
Right 1050423432 9:5490441-5490463 GCCCTCCCACAACTGTCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050423430 Original CRISPR GTGGGAGGGCAAATATTTGG AGG (reversed) Intergenic
No off target data available for this crispr