ID: 1050423432

View in Genome Browser
Species Human (GRCh38)
Location 9:5490441-5490463
Sequence GCCCTCCCACAACTGTCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050423430_1050423432 -10 Left 1050423430 9:5490428-5490450 CCTCCAAATATTTGCCCTCCCAC No data
Right 1050423432 9:5490441-5490463 GCCCTCCCACAACTGTCCATAGG No data
1050423429_1050423432 7 Left 1050423429 9:5490411-5490433 CCTGTGGGTAGGGATAGCCTCCA No data
Right 1050423432 9:5490441-5490463 GCCCTCCCACAACTGTCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050423432 Original CRISPR GCCCTCCCACAACTGTCCAT AGG Intergenic
No off target data available for this crispr