ID: 1050423439

View in Genome Browser
Species Human (GRCh38)
Location 9:5490465-5490487
Sequence CTAGTTGCCCTGCCATAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050423434_1050423439 -1 Left 1050423434 9:5490443-5490465 CCTCCCACAACTGTCCATAGGCC No data
Right 1050423439 9:5490465-5490487 CTAGTTGCCCTGCCATAGCTAGG No data
1050423433_1050423439 0 Left 1050423433 9:5490442-5490464 CCCTCCCACAACTGTCCATAGGC No data
Right 1050423439 9:5490465-5490487 CTAGTTGCCCTGCCATAGCTAGG No data
1050423435_1050423439 -4 Left 1050423435 9:5490446-5490468 CCCACAACTGTCCATAGGCCTAG No data
Right 1050423439 9:5490465-5490487 CTAGTTGCCCTGCCATAGCTAGG No data
1050423436_1050423439 -5 Left 1050423436 9:5490447-5490469 CCACAACTGTCCATAGGCCTAGT No data
Right 1050423439 9:5490465-5490487 CTAGTTGCCCTGCCATAGCTAGG No data
1050423431_1050423439 11 Left 1050423431 9:5490431-5490453 CCAAATATTTGCCCTCCCACAAC No data
Right 1050423439 9:5490465-5490487 CTAGTTGCCCTGCCATAGCTAGG No data
1050423430_1050423439 14 Left 1050423430 9:5490428-5490450 CCTCCAAATATTTGCCCTCCCAC No data
Right 1050423439 9:5490465-5490487 CTAGTTGCCCTGCCATAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050423439 Original CRISPR CTAGTTGCCCTGCCATAGCT AGG Intergenic
No off target data available for this crispr