ID: 1050424865

View in Genome Browser
Species Human (GRCh38)
Location 9:5502383-5502405
Sequence CATTGTCATCAGAGTGTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050424856_1050424865 19 Left 1050424856 9:5502341-5502363 CCCCTCCTTTCCCTGCAGCACTG No data
Right 1050424865 9:5502383-5502405 CATTGTCATCAGAGTGTTGTTGG No data
1050424857_1050424865 18 Left 1050424857 9:5502342-5502364 CCCTCCTTTCCCTGCAGCACTGT No data
Right 1050424865 9:5502383-5502405 CATTGTCATCAGAGTGTTGTTGG No data
1050424864_1050424865 -5 Left 1050424864 9:5502365-5502387 CCACTGTGATGGCAATGGCATTG No data
Right 1050424865 9:5502383-5502405 CATTGTCATCAGAGTGTTGTTGG No data
1050424861_1050424865 8 Left 1050424861 9:5502352-5502374 CCTGCAGCACTGTCCACTGTGAT No data
Right 1050424865 9:5502383-5502405 CATTGTCATCAGAGTGTTGTTGG No data
1050424855_1050424865 23 Left 1050424855 9:5502337-5502359 CCTGCCCCTCCTTTCCCTGCAGC No data
Right 1050424865 9:5502383-5502405 CATTGTCATCAGAGTGTTGTTGG No data
1050424858_1050424865 17 Left 1050424858 9:5502343-5502365 CCTCCTTTCCCTGCAGCACTGTC No data
Right 1050424865 9:5502383-5502405 CATTGTCATCAGAGTGTTGTTGG No data
1050424860_1050424865 9 Left 1050424860 9:5502351-5502373 CCCTGCAGCACTGTCCACTGTGA No data
Right 1050424865 9:5502383-5502405 CATTGTCATCAGAGTGTTGTTGG No data
1050424859_1050424865 14 Left 1050424859 9:5502346-5502368 CCTTTCCCTGCAGCACTGTCCAC No data
Right 1050424865 9:5502383-5502405 CATTGTCATCAGAGTGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050424865 Original CRISPR CATTGTCATCAGAGTGTTGT TGG Intergenic
No off target data available for this crispr