ID: 1050430015

View in Genome Browser
Species Human (GRCh38)
Location 9:5552822-5552844
Sequence TTGTGGATAGGTAGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 318}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050430015 Original CRISPR TTGTGGATAGGTAGGGAAGT GGG (reversed) Intronic
900005172 1:40582-40604 TTGGGGATGGGGATGGAAGTGGG - Intergenic
900532487 1:3161500-3161522 TTGTGGATGGGTCGGGAATGGGG + Intronic
902360761 1:15941529-15941551 TTGGGGAGAGGTTGGGAAGTTGG - Intergenic
902798385 1:18814515-18814537 TTGGGGTTAGGGAGGGGAGTAGG - Intergenic
902990112 1:20181531-20181553 TTTTGGATAGGCACGGAAGCAGG - Intergenic
905441800 1:38000675-38000697 GAGTGGAGCGGTAGGGAAGTGGG + Intronic
905560434 1:38922599-38922621 GGGTGGAGAGGTATGGAAGTTGG - Intronic
906162388 1:43659935-43659957 CTGTGGATATGTAGGGACCTTGG + Intronic
906379019 1:45319777-45319799 TTGTTGAGAGGTAGTGGAGTGGG - Intergenic
908344045 1:63213294-63213316 TTGTGGAGAGGTAGGGAGTTAGG - Intergenic
908680802 1:66659047-66659069 ATGAGGATGGGAAGGGAAGTTGG + Intronic
908692683 1:66800465-66800487 ATGTGGTTAGGTAGGAAACTGGG - Intronic
909873999 1:80779717-80779739 TTGGTGATAAGTAGGGTAGTCGG - Intergenic
910537295 1:88312968-88312990 TTGTAGGTAGGTAGGTAGGTAGG + Intergenic
910922244 1:92360658-92360680 TTGCAGATATGTAGGAAAGTGGG - Intronic
912938957 1:114028227-114028249 TTGTGATTAGGAAGGGAAGAAGG - Intergenic
915832403 1:159143169-159143191 ATATGAATGGGTAGGGAAGTGGG - Intronic
916011420 1:160709550-160709572 TTGTGGACAGATGGGGAATTGGG + Intronic
916225128 1:162482306-162482328 TAGAGGATAGGAAGGGTAGTAGG + Intergenic
916519146 1:165547732-165547754 ATGTGGATGGGTACGTAAGTAGG - Intronic
916521844 1:165570356-165570378 TTGAGGAAATGTAGGGAGGTGGG - Intergenic
916725426 1:167518343-167518365 TTGTGTATGTGTAGGGGAGTGGG - Intronic
918010011 1:180577907-180577929 TTGTGGCTAGGAAGGGAATGAGG - Intergenic
921437500 1:215142601-215142623 TTGTGGACAGACAGTGAAGTTGG + Intronic
921849741 1:219922396-219922418 TTGTTGAGAGGTAGGTAATTTGG + Intronic
921924701 1:220701809-220701831 TTGAGGAAAGTTAGGGAATTTGG + Intergenic
922574548 1:226653265-226653287 TCGTTGATAGGCACGGAAGTGGG - Intronic
923264114 1:232296707-232296729 TTGAGACTAGGTAGGGAAATAGG + Intergenic
924016845 1:239735981-239736003 TTGGGGATAGGCATTGAAGTTGG - Intronic
924337912 1:243001584-243001606 TTTGAGATAGGGAGGGAAGTGGG + Intergenic
924747620 1:246851834-246851856 GTGTGGATAGTTAGGTAATTTGG - Intronic
1063653625 10:7965008-7965030 TTGTGGAGAGGTTCGGGAGTGGG - Exonic
1064358661 10:14643095-14643117 TTGGAGATAGGTAGGTAGGTAGG + Intronic
1064556713 10:16553845-16553867 TTGGGGAAAGGGTGGGAAGTGGG - Intergenic
1064566739 10:16647292-16647314 TTGTGGATAGGTATGTAAAGTGG + Intronic
1065001066 10:21337897-21337919 TTGAGAAAAGGAAGGGAAGTAGG - Intergenic
1065762552 10:28995774-28995796 CTGTGGAAAGGTAGAGAAGTGGG - Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1067177902 10:43962948-43962970 TTGTGGTTATGTAAGGAATTTGG - Intergenic
1068598747 10:58933604-58933626 ATCTCGATAGGTAGAGAAGTGGG + Intergenic
1069024940 10:63529358-63529380 CTGGAGATAGATAGGGAAGTAGG + Intronic
1070665478 10:78339506-78339528 TTGTGAATAAATAGGCAAGTTGG + Intergenic
1074544702 10:114393579-114393601 CTGGGGACAGGGAGGGAAGTTGG + Intronic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077700361 11:4435624-4435646 GTGTGGGTAGGTGGGGTAGTTGG + Intergenic
1078350143 11:10586196-10586218 TTGTGGGTAGGGTGGCAAGTGGG + Intronic
1078720613 11:13880387-13880409 TGGTGGTAAGGTTGGGAAGTTGG - Intergenic
1079589980 11:22170796-22170818 GTGTGGATAGGTAGGTAAGTAGG + Intergenic
1080693674 11:34582018-34582040 TTGTGGATGCCTGGGGAAGTCGG + Intergenic
1081481675 11:43495611-43495633 TTGTGGTGAGGTGGGGAAGCAGG - Intergenic
1083266000 11:61547033-61547055 GGGTGGATGGGTGGGGAAGTTGG + Intronic
1084692594 11:70735720-70735742 ATGTGCAGAGGGAGGGAAGTGGG + Intronic
1084862113 11:72025884-72025906 TTGTGGGTGGGTAGGGAAAATGG - Intronic
1085059975 11:73436749-73436771 TTGAGGAGAGGCAGGGAGGTTGG - Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1085848897 11:80097561-80097583 TTTTGGATAGGTAGAGATGGTGG - Intergenic
1085969214 11:81566627-81566649 ATGTAGATAGGTAGGCATGTAGG - Intergenic
1086004803 11:82026033-82026055 TTAGGGATAGTGAGGGAAGTTGG - Intergenic
1086294890 11:85354127-85354149 TTGTGGAGATATAGGGTAGTGGG - Intronic
1088038877 11:105351884-105351906 TTGTGTATATGAAGGGAGGTAGG - Intergenic
1088952019 11:114581410-114581432 TTGTGGTGAGGTAAAGAAGTGGG + Intronic
1089240495 11:117074331-117074353 TTGTGGGGCTGTAGGGAAGTGGG - Intronic
1089428441 11:118400741-118400763 TTGTGGTTAACTAGGGAATTAGG + Intronic
1090336830 11:125974339-125974361 TTGTAGGTAGGTAGGTAGGTAGG + Intronic
1090579704 11:128146413-128146435 TTGTGGTTAGGCAGCAAAGTTGG + Intergenic
1091007084 11:131963026-131963048 TTCTGGAAAAGTAAGGAAGTGGG - Intronic
1091379159 12:44757-44779 TTGGGGATGGGGATGGAAGTGGG - Intergenic
1093276608 12:17136751-17136773 TAGTGTACAGGAAGGGAAGTGGG - Intergenic
1096022539 12:48334091-48334113 GGGTGGAGAGGTATGGAAGTTGG + Intergenic
1097880674 12:64683464-64683486 GTGTGGGGAGGTAGAGAAGTGGG + Intronic
1099222987 12:79935537-79935559 TGGAGGATAGGTCGTGAAGTAGG + Intergenic
1099524649 12:83704969-83704991 TTGGGGAGAGGTGGGGAAGGGGG - Intergenic
1100856418 12:98761494-98761516 TTGTGGAAAGGTATGGGAGCTGG - Intronic
1100897062 12:99194881-99194903 TTGTTGATAGGTTTTGAAGTTGG + Intronic
1101601691 12:106215362-106215384 CTGAGGTTAGGTGGGGAAGTGGG + Intergenic
1105612859 13:21984415-21984437 TTCTGGAGAGGGAGGGAAGGAGG + Intergenic
1106062777 13:26310943-26310965 TTGTGGGTGGGTAGGGAGGAGGG - Intronic
1106421971 13:29592621-29592643 TTGTAGATGGGTATGGGAGTGGG + Intronic
1106808097 13:33332176-33332198 CTGTGGATAGGTGGGGAGGTGGG - Intronic
1108962449 13:56251679-56251701 TTGGGGATGGGTAGGGAGGATGG - Intergenic
1109353218 13:61209084-61209106 TTGCTGAGAGGTAGTGAAGTGGG - Intergenic
1114238741 14:20846646-20846668 TGGTAGAAAGGAAGGGAAGTAGG + Intergenic
1116520720 14:45843546-45843568 TAGTAGGTAGGTAGGTAAGTAGG + Intergenic
1118343468 14:64915564-64915586 TTGTGCATTGGTTGGGAAGGAGG + Intronic
1118814191 14:69298342-69298364 TTGTAGATAGGGAGTGGAGTGGG + Intronic
1120844892 14:89117037-89117059 TTGTGGACAGGGAGGGAAATTGG - Intergenic
1121141601 14:91547267-91547289 TTATGGAGTGGCAGGGAAGTGGG + Intergenic
1121642098 14:95492132-95492154 TGGTGAAGATGTAGGGAAGTTGG + Intergenic
1122079910 14:99259479-99259501 GTGTGAATAGGTAGCGACGTAGG + Intronic
1123427821 15:20187238-20187260 TTGTGGATGGGTGGGGCAGCAGG - Intergenic
1123469839 15:20541614-20541636 GTGGGGATGGGTAGGGAGGTGGG + Exonic
1123469847 15:20541632-20541654 GTGGGGATGGGTAGGGAGGTGGG + Exonic
1123469855 15:20541650-20541672 GTGGGGATGGGTAGGGAGGTGGG + Exonic
1123469863 15:20541668-20541690 GTGGGGATGGGTAGGGAGGTGGG + Exonic
1123648192 15:22459013-22459035 GTGGGGATGGGTAGGGAGGTGGG - Intronic
1123648200 15:22459031-22459053 GTGGGGATGGGTAGGGAGGTGGG - Intronic
1123648208 15:22459049-22459071 GTGGGGATGGGTAGGGAGGTGGG - Intronic
1123648216 15:22459067-22459089 GTGGGGATGGGTAGGGAGGTGGG - Intronic
1123648224 15:22459085-22459107 GTGGGGATGGGTAGGGAGGTGGG - Intronic
1123730117 15:23136600-23136622 GTGGGGATGGGTAGGGAGGTGGG + Exonic
1123730125 15:23136618-23136640 GTGGGGATGGGTAGGGAGGTGGG + Exonic
1123730133 15:23136636-23136658 GTGGGGATGGGTAGGGAGGTGGG + Exonic
1123730141 15:23136654-23136676 GTGGGGATGGGTAGGGAGGTGGG + Exonic
1123730149 15:23136672-23136694 GTGGGGATGGGTAGGGAGGTGGG + Exonic
1123730157 15:23136690-23136712 GTGGGGATGGGTAGGGAGGTGGG + Exonic
1123748287 15:23334082-23334104 GTGGGGATGGGTAGGGAGGTGGG + Intergenic
1123748295 15:23334100-23334122 GTGGGGATGGGTAGGGAGGTGGG + Intergenic
1124030922 15:26011000-26011022 TTGGAGATAGATAGGGAAATTGG - Intergenic
1124280650 15:28357934-28357956 GTGGGGATGGGTAGGGAGGTGGG + Intergenic
1124280658 15:28357952-28357974 GTGGGGATGGGTAGGGAGGTGGG + Intergenic
1124280666 15:28357970-28357992 GTGGGGATGGGTAGGGAGGTGGG + Intergenic
1124280674 15:28357988-28358010 GTGGGGATGGGTAGGGAGGTGGG + Intergenic
1124302031 15:28553642-28553664 GTGGGGATGGGTAGGGAGGTGGG - Intergenic
1124302039 15:28553660-28553682 GTGGGGATGGGTAGGGAGGTGGG - Intergenic
1124302047 15:28553678-28553700 GTGGGGATGGGTAGGGAGGTGGG - Intergenic
1124474984 15:30025558-30025580 TTGTGGGTAGGTAGGGGAAAGGG - Intergenic
1124856412 15:33393527-33393549 TTATTGATAGGGAGGGAAGCAGG + Intronic
1127677648 15:61258088-61258110 TTGGGGAGAGGGATGGAAGTGGG + Intergenic
1128507788 15:68288911-68288933 TTGGGGAGAGGTAGTGAAATGGG - Intronic
1129783419 15:78290502-78290524 TCGTGGAGAAGTAAGGAAGTAGG - Intronic
1129871704 15:78945405-78945427 TTGGGGATAGGCAGGGAGATGGG - Intronic
1131337378 15:91562277-91562299 TTGGGGATTTCTAGGGAAGTAGG + Intergenic
1131645390 15:94336607-94336629 TGGTCGTTAGGAAGGGAAGTGGG + Intronic
1132448341 15:101950362-101950384 TTGGGGATGGGGATGGAAGTGGG + Intergenic
1132986068 16:2768304-2768326 TTGGGGATGGGTTGGGGAGTGGG + Intronic
1133163381 16:3927993-3928015 TTGTAGGTAGGTAGGTAGGTAGG - Intergenic
1133462717 16:6000879-6000901 GGGTGGATAGGTAGGTAGGTGGG + Intergenic
1133463724 16:6009700-6009722 TTGTGGATAGGCTTGGAGGTGGG - Intergenic
1133744906 16:8678907-8678929 ACATGGATAGTTAGGGAAGTGGG + Intronic
1134037237 16:11040300-11040322 TTGTGGGTAGGTATGGAAACAGG + Intronic
1134433673 16:14235438-14235460 TTGAGGATCGGCAGGGAAGGAGG - Intronic
1134787873 16:16961486-16961508 TTGTGGTTAAGCAGGGAAGAGGG - Intergenic
1135805140 16:25535889-25535911 TGGTGGAAAGGAAGGGGAGTTGG - Intergenic
1138990884 16:62389441-62389463 AGGTGGAAAGGTTGGGAAGTGGG + Intergenic
1139550922 16:67672586-67672608 GTGTGGATAGGGAGGGATCTTGG + Intergenic
1142858436 17:2746610-2746632 TTGTAACTGGGTAGGGAAGTGGG - Intergenic
1147790922 17:43013973-43013995 TGGTGGGTAGGTAGGTCAGTGGG - Intronic
1148008351 17:44453477-44453499 TTGTAGGTAGGTAGGTAGGTAGG + Intronic
1148160917 17:45449721-45449743 AGGTGGATGGGTAGGTAAGTAGG - Intronic
1149681134 17:58508148-58508170 TTGTGTATAGGTGAGGCAGTGGG - Exonic
1154029393 18:10738868-10738890 GTGTACATAGGTATGGAAGTAGG + Intronic
1155142864 18:23058732-23058754 TTGTGGAGGGGTAGGGAAAAAGG - Intergenic
1155252500 18:23965736-23965758 TTGTGTACAGGTGGGGAATTTGG + Intergenic
1155294199 18:24370600-24370622 GTGTGGACAGGCTGGGAAGTTGG - Intronic
1155569898 18:27181914-27181936 TTGTGGGGAGGTGGGGAAGATGG - Intronic
1155645494 18:28072264-28072286 TTGTGGACAGGTAGGTGATTAGG - Intronic
1156261063 18:35445344-35445366 TTGTGGGGAGGGAGGGAGGTGGG + Intronic
1157395389 18:47336772-47336794 GTGTGGACAGGGAGGGAAGTGGG + Intergenic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1160636926 19:82191-82213 TTGGGGATGGGGATGGAAGTGGG - Intergenic
1164828947 19:31305613-31305635 TTGTGGATAGAAAGAGAAGAGGG + Intronic
1166182225 19:41117004-41117026 TTGTGGATAGGGATGAAGGTGGG - Intronic
1168492960 19:56825943-56825965 GTTTGCATAGGGAGGGAAGTGGG - Intronic
927784549 2:25964703-25964725 GTGTGGATAGCTGGGGAAGGTGG - Intronic
928342645 2:30458501-30458523 TTTTGGATGAGTAGGGAGGTAGG + Intronic
928923676 2:36553958-36553980 GTGTGGGAAGGTGGGGAAGTCGG - Intronic
930380932 2:50627321-50627343 TTGATGATAGGTAGTCAAGTGGG + Intronic
930603308 2:53466793-53466815 TTATAGATAGGTAGGTAGGTAGG + Intergenic
931277612 2:60756998-60757020 TTGTGGGTAGGTGGGGAAGCAGG - Intronic
931910206 2:66890816-66890838 TTGAGGATGGGATGGGAAGTGGG + Intergenic
932453496 2:71831268-71831290 TTCTGGAGAGGTAGGGAATCTGG + Intergenic
932879568 2:75488559-75488581 TTGAGGATAGGTAGAAAAGTGGG + Intronic
933592169 2:84245126-84245148 TTCAGGATATGTAGAGAAGTTGG + Intergenic
934126440 2:88897375-88897397 TTGTGGATATGCAGGGGACTTGG - Intergenic
934993648 2:98938024-98938046 TTGTGAATAGGTTGGGAAAATGG + Intergenic
935571178 2:104661253-104661275 TGGTGGGTAGGTAGGGAAGGGGG + Intergenic
936564550 2:113572850-113572872 TTGGGGATGGGGATGGAAGTGGG + Intergenic
936870946 2:117133564-117133586 TTGCTGAGAGGTAGTGAAGTGGG - Intergenic
939977837 2:148739626-148739648 TTCTGTGTAGGTAAGGAAGTGGG - Intronic
940502204 2:154506762-154506784 GTGTGGATTGGCAAGGAAGTAGG + Intergenic
940724325 2:157318668-157318690 TTGTGGATAGTTTGGTAGGTAGG + Exonic
943843864 2:192615495-192615517 TTCTGGATATGTAAGGAAGTAGG + Intergenic
944599420 2:201288216-201288238 TGATTGAGAGGTAGGGAAGTAGG + Intergenic
944931529 2:204525248-204525270 CTGGGGATAAGTGGGGAAGTGGG + Intergenic
945269225 2:207922261-207922283 TTTTAGATAGGTAGGGCAGATGG - Intronic
946141921 2:217698665-217698687 TTCTGGAGAGGGAGGGAAGCGGG + Intronic
946522303 2:220479714-220479736 CTGTGGAGAGGTAAGGAAGAAGG - Intergenic
947845552 2:233241079-233241101 TTGTGGTTTGGTCAGGAAGTGGG - Intronic
1168941943 20:1720285-1720307 TTGAACATAGGTAGGGAAGGTGG - Intergenic
1169496958 20:6124165-6124187 ATGTTAAGAGGTAGGGAAGTGGG - Intergenic
1169522949 20:6392751-6392773 TTTTTGATAGGTAGGTAGGTAGG - Intergenic
1170002508 20:11630709-11630731 TTGTGGGTAGGTTGTGAAATGGG + Intergenic
1172298315 20:33829878-33829900 TAGTAGATAGGAAGGGAAGAAGG + Intronic
1173120196 20:40282112-40282134 AAGTGGAAAGGTATGGAAGTGGG + Intergenic
1173439882 20:43066697-43066719 TGGTGGAAGGGTAGGGAAGGTGG + Intronic
1174211875 20:48886152-48886174 TTGTGAATATGTAGGGATGGGGG + Intergenic
1174935333 20:54861631-54861653 TGGTGGAGAGATAGGCAAGTTGG - Intergenic
1175442658 20:59002297-59002319 TTGTGCATGGGAAGGGAAGCAGG - Intronic
1178524188 21:33311777-33311799 TGTAGGATAAGTAGGGAAGTAGG - Intergenic
1179040818 21:37800963-37800985 TTGATGAGAGGTAGGGAAGACGG + Intronic
1180959472 22:19756090-19756112 TTATGGATAGGAGGGGAAGGGGG + Intergenic
1181458846 22:23074458-23074480 TTCTGGAGAGGTGGGGAATTAGG + Intronic
1182560087 22:31152862-31152884 GTGTGGAGAGGGAGGGAGGTGGG - Intergenic
1183506277 22:38210744-38210766 TTGTGGATATCTAGGGAACAAGG + Intronic
1184690568 22:46115490-46115512 TGGAGGGTAGGGAGGGAAGTGGG - Intergenic
1184806679 22:46799127-46799149 CTGTGGAAAGGAAGGGAAGGTGG - Intronic
1184960016 22:47921993-47922015 TTGTGGAGTGGAAGGGAGGTGGG - Intergenic
949743743 3:7264709-7264731 ATGTGGAGAGGTAGGCAAGATGG - Intronic
950173459 3:10855039-10855061 AGGTAGATAGGTAGGGAATTGGG + Intronic
950551643 3:13669684-13669706 TGATGGATAGGTAGGTCAGTGGG - Intergenic
951839118 3:27014766-27014788 TTCTGTATAGGTGGGGCAGTTGG - Intergenic
953564650 3:44021432-44021454 TTGGGTATAGGGAGGGAAGGAGG - Intergenic
955672798 3:61419324-61419346 TGGGGGAGAGGTAGGAAAGTGGG - Intergenic
958188035 3:90148252-90148274 TTGAAGATAGGGAAGGAAGTAGG - Intergenic
958410555 3:93810077-93810099 TTGAAGATAGGGAAGGAAGTAGG - Intergenic
959647312 3:108717825-108717847 TTGTGGATGTGTAAGGAAATGGG - Intergenic
960610007 3:119547065-119547087 TTTAAGGTAGGTAGGGAAGTAGG - Intronic
961464010 3:127070599-127070621 TTGTGGATAAGAAGGGCTGTGGG - Intergenic
961603777 3:128078875-128078897 TTCTGGATAGGTAGGAAGGTGGG - Intronic
962388134 3:134949405-134949427 GTGTGGAGAGGTGGGGAAATGGG - Intronic
963320073 3:143801742-143801764 TTGTTGAGAGGTAGTGGAGTAGG - Intronic
966431081 3:179832347-179832369 TGGTGGGTAGGTAGGCAGGTGGG - Intronic
966431203 3:179832836-179832858 TGGTGGGTAGGTAGGTAGGTGGG - Intronic
968466181 4:752568-752590 TTGTGGATAAGGAGTGAGGTGGG + Intronic
968621205 4:1604203-1604225 GTGTGGATGGGTGGGGAAGAAGG + Intergenic
969145777 4:5123085-5123107 CTGTGGGGAGGTGGGGAAGTTGG - Intronic
973053233 4:45620924-45620946 TTGTGGATATGAATGCAAGTAGG - Intergenic
973301099 4:48585387-48585409 GTGTGAAAAGCTAGGGAAGTGGG + Intronic
980349383 4:131666962-131666984 TTGCTGAGAGGTAGGGGAGTGGG - Intergenic
981287291 4:143033234-143033256 TAGTGGATGGGGAGGGAAGTGGG + Intergenic
981747051 4:148062133-148062155 TTGTGTATAGGGAGACAAGTGGG + Intronic
981931190 4:150190936-150190958 ATGTAGATAGGTAGGTAGGTAGG - Intronic
982261552 4:153498551-153498573 TTGGAGGTGGGTAGGGAAGTGGG + Intronic
982605886 4:157515508-157515530 TTGGGGATGGGCTGGGAAGTTGG + Intergenic
983499193 4:168480182-168480204 TCGCGGAGAGGTAGGGAAGAGGG - Intronic
983565733 4:169149654-169149676 TTGTGGGTAAGTTGGGAAGAGGG - Intronic
984623120 4:181975736-181975758 TTGTGGATAAATATGGAAGCCGG + Intergenic
984887512 4:184463722-184463744 TTTTGGATTGCTACGGAAGTAGG - Intronic
985239147 4:187911101-187911123 TTGTGGACAGGAACGGAGGTAGG + Intergenic
985764523 5:1769706-1769728 TTGTGGATAGGCCTGGAGGTGGG - Intergenic
986969074 5:13311093-13311115 GTGGGGATAGGTAGGTAGGTGGG + Intergenic
988051620 5:26038355-26038377 TGGTAGATAGGTAGGTATGTTGG + Intergenic
988846610 5:35134028-35134050 TTGGGGAAAGGTTGGGAAGGGGG + Intronic
989410420 5:41113621-41113643 TTGAGGATGGATAGTGAAGTAGG + Intergenic
991921578 5:71662771-71662793 TAGTGGATGGCTAGGGAAGGTGG + Intergenic
993434047 5:87869546-87869568 TGGTGGGTGGGTAGGTAAGTAGG - Intergenic
993808743 5:92446621-92446643 TTGTGAATGTGTTGGGAAGTTGG - Intergenic
994041818 5:95267596-95267618 TTGTAAAGAGATAGGGAAGTAGG - Intronic
995503325 5:112832653-112832675 ATGAGGAAAGGCAGGGAAGTGGG - Intronic
998465835 5:142342954-142342976 TTGTGTATAGGTGGAGAACTTGG + Intergenic
999033874 5:148325409-148325431 TGGTGAATAGGTAGAGAAATTGG - Intronic
999285128 5:150390070-150390092 ATGTGGGTAAGTATGGAAGTAGG - Intronic
999324956 5:150638086-150638108 ATGGGGGTAGGTAGGGGAGTGGG + Intronic
1001106613 5:168859972-168859994 GTGTGGATAGGTAGGGAAAGAGG - Intronic
1001791116 5:174458648-174458670 GTGTGGGGAGGTAGGGAGGTGGG - Intergenic
1003173217 6:3736366-3736388 TGGTGGACAGGGAGGGAAGGGGG - Intronic
1003288131 6:4752858-4752880 TTGTAGATAGGTAGGTAGGTAGG + Intronic
1003984769 6:11424802-11424824 ATTTGGACAGGTTGGGAAGTTGG + Intergenic
1003988264 6:11459939-11459961 TTCCAGATAGGTAGGTAAGTAGG - Intergenic
1004980330 6:21016402-21016424 TTGATGAAAGGTAGGGAAGGTGG - Intronic
1006137356 6:31903124-31903146 ACTTGGATAGGTGGGGAAGTGGG - Intronic
1006463619 6:34177928-34177950 TTGGGGGTAGGTAAGGAATTGGG + Intergenic
1006530403 6:34647498-34647520 TTGCGGATAGGATGGGAAGGAGG + Intronic
1006600235 6:35220494-35220516 TAGAGGATGGGTAGTGAAGTGGG - Intronic
1008267389 6:49445505-49445527 CTGTGGATAGGGTGGGCAGTGGG - Intronic
1008626249 6:53319673-53319695 TTGTGGAAAGAAAAGGAAGTTGG - Intronic
1009035444 6:58112329-58112351 GTATGGGGAGGTAGGGAAGTGGG - Intergenic
1009211259 6:60865921-60865943 GTATGGGGAGGTAGGGAAGTGGG - Intergenic
1010259777 6:73802345-73802367 TGGTGGGTAGGCAGGCAAGTTGG + Intronic
1011207657 6:84917635-84917657 TTGTATATAAGTAGGGAATTTGG - Intergenic
1011211929 6:84964718-84964740 TTGTTGTTAGGTAGGGTAGAAGG + Intergenic
1011300634 6:85869153-85869175 TTGTGGATAGGAACGGGGGTGGG - Intergenic
1011483303 6:87816569-87816591 TTGTGGATAGGAGGTGAAGTGGG + Intergenic
1013282289 6:108649689-108649711 TTGTGGATAGAAAGGGAAGTAGG - Intronic
1014005235 6:116410288-116410310 TTGTGGGAAGGGAGGGAACTGGG - Intronic
1015282891 6:131452774-131452796 TTGGGGAATAGTAGGGAAGTGGG + Intergenic
1015327917 6:131945774-131945796 TTGGGGTTAGGCAGGAAAGTTGG - Intergenic
1015383286 6:132593965-132593987 TTGTTGCTTGTTAGGGAAGTGGG - Intergenic
1017393714 6:153971684-153971706 TTGTGCATAGGAAGGGTAGAGGG - Intergenic
1023413149 7:39908092-39908114 TTGTGTATAGGGTGGGAGGTGGG - Intergenic
1026223786 7:68423137-68423159 CTGTGGATAGGTAAGCAAATGGG + Intergenic
1028272449 7:88809394-88809416 TGGTAGATAGGTAGGTAGGTTGG - Intronic
1029410798 7:100409121-100409143 TGGTGGATAGGGAGGGATATAGG - Intronic
1029641754 7:101825188-101825210 GTGTGAATAGGAAGGGAAGATGG - Intronic
1030679443 7:112419359-112419381 TGGTGGCTAGGAAGGGTAGTGGG + Intergenic
1032392200 7:131562604-131562626 GTGTGGATGGGAAGGGAAGGAGG + Intergenic
1032429409 7:131848769-131848791 TTCTGGATAGGGAGGGACGTTGG - Intergenic
1033683897 7:143621584-143621606 TGGCGGATAGGAAGGGAAGAGGG + Intronic
1033700715 7:143836054-143836076 TGGCGGATAGGAAGGGAAGAGGG - Intergenic
1034697454 7:153066468-153066490 AGGTGGAGAGGTAGGGAAGGAGG + Intergenic
1035531107 8:351474-351496 AGGTAGATAGGTAGGTAAGTAGG + Intergenic
1037121495 8:15293052-15293074 TAGTGCAAGGGTAGGGAAGTGGG - Intergenic
1037552278 8:19986098-19986120 TTGTGCATAGGGAGGCAAGGTGG + Intergenic
1039101363 8:33945504-33945526 TTGTGCATTGGTAGGGTAGTTGG - Intergenic
1040750939 8:50706595-50706617 TTGTGAATGGGTAAGGAAATAGG - Intronic
1040996679 8:53409296-53409318 TTGAGGAAAGGAAGGGAAGAAGG + Intergenic
1042694182 8:71538578-71538600 GTGTAGATAGGCAGGCAAGTAGG - Intronic
1043285959 8:78531766-78531788 TTGTGGAAAGAAAGGGAAGGAGG + Intronic
1044326289 8:90862317-90862339 GTGTGGCTAGGTAATGAAGTGGG + Intronic
1046254804 8:111681945-111681967 TTGTGGGGGGGTAGGGTAGTGGG - Intergenic
1046337360 8:112807482-112807504 TTCTTGATAGGTAGGTAGGTAGG + Intronic
1047300748 8:123611886-123611908 GTGTGCATGTGTAGGGAAGTAGG + Intergenic
1047650859 8:126918737-126918759 TTGGGGATAGAAAGAGAAGTAGG - Intergenic
1047678808 8:127232499-127232521 TTGTTGATAGATAGGGAAATAGG - Intergenic
1047830294 8:128622216-128622238 ATGTGTATTGCTAGGGAAGTAGG + Intergenic
1047980988 8:130181939-130181961 CTGTGTATAGGTAAGGATGTTGG - Intronic
1048036458 8:130682040-130682062 TTGTGGTTGGGTGGGGCAGTGGG + Intergenic
1049887870 9:40364-40386 TTGGGGATGGGGATGGAAGTGGG - Intergenic
1050227942 9:3483115-3483137 TAGTGGATGGGCAGGCAAGTGGG + Intronic
1050430015 9:5552822-5552844 TTGTGGATAGGTAGGGAAGTGGG - Intronic
1051618127 9:19026514-19026536 CTGTGGTTAGGTGGGGGAGTGGG - Intronic
1051885048 9:21883761-21883783 TAGTGTACAGGTAGGGAAGCAGG + Intronic
1052682468 9:31711296-31711318 TTTTGGTTAGGTAGAGAGGTTGG - Intergenic
1052748959 9:32469199-32469221 ATGTGGATAGGTAGGGGTGGGGG - Intronic
1053008179 9:34618129-34618151 GAGTGGAGAGATAGGGAAGTGGG - Intronic
1053783390 9:41633114-41633136 TTGCTGAGAGGTAGGGGAGTGGG + Intergenic
1054171344 9:61843256-61843278 TTGCTGAGAGGTAGGGGAGTGGG + Intergenic
1054666190 9:67737556-67737578 TTGCTGAGAGGTAGGGGAGTGGG - Intergenic
1054729589 9:68687149-68687171 TGGAGGAATGGTAGGGAAGTTGG - Intergenic
1056406340 9:86279427-86279449 TTCTAGATATGTAGGGAAATAGG + Intronic
1057077240 9:92144393-92144415 TTGGGGATCGGGAGGGAAGGTGG + Intergenic
1185854120 X:3518107-3518129 ATTTTGATAGGTAGGAAAGTAGG + Intergenic
1185933523 X:4229976-4229998 AGGTGGATAGGTAGGTAGGTAGG - Intergenic
1185999178 X:4989169-4989191 TAGAGGATAGGAAGGGAAGGAGG - Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186297571 X:8166915-8166937 TTGTGGATAGTTGGAGAAGGAGG + Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186325305 X:8470461-8470483 TTGTGGATAGTTGGAGAAGGAGG - Intergenic
1186335251 X:8579910-8579932 TGGTAGGTAGGAAGGGAAGTAGG - Intronic
1187020619 X:15377680-15377702 TTGTGGCTAGATGGGGCAGTGGG + Intronic
1188843685 X:35047009-35047031 TTTTAGACAGGCAGGGAAGTTGG - Intergenic
1189539760 X:41973549-41973571 TTTTGGACAGGTTGGGAAGAGGG + Intergenic
1190305491 X:49079412-49079434 TTGAGGATTTGAAGGGAAGTTGG - Intronic
1192211953 X:69133310-69133332 TGGAGGACAGGTGGGGAAGTGGG - Intergenic
1193181282 X:78460132-78460154 TGGTGGATAGGGAAGGAAATGGG - Intergenic
1196410279 X:115411285-115411307 TTGTGGTTAGGGAGGGAGGGAGG + Intergenic
1196595591 X:117541973-117541995 TTGAGGAGAGGTAGCGCAGTAGG - Intergenic
1196828782 X:119760228-119760250 TTGTGGTTAGTAAGGGAGGTGGG - Intergenic
1196882901 X:120215158-120215180 TGGGGGATAGGTAGGGGAGTTGG + Intergenic
1197922774 X:131612922-131612944 TTGTGGATACCTAAGGAACTAGG + Intergenic
1198508113 X:137321503-137321525 TTGAGTATAGGTAGGGAACGAGG - Intergenic
1198625735 X:138571288-138571310 TTATGGATATGTAGGTAGGTAGG + Intergenic
1199612836 X:149632193-149632215 TTGGGAATTGGAAGGGAAGTTGG - Intergenic
1199825837 X:151498419-151498441 GTGTGGACAGGGAGGGAGGTGGG + Intergenic
1199900309 X:152166375-152166397 TTGTGGATATGTGGGGATATGGG - Exonic
1200809340 Y:7466185-7466207 AGTTGAATAGGTAGGGAAGTAGG - Intergenic
1201286693 Y:12385064-12385086 TTATAGATAGGTAGGTAAGTAGG + Intergenic
1201337119 Y:12893110-12893132 TTCTGGATAGGAAAAGAAGTGGG - Intergenic
1201438248 Y:13982023-13982045 TTGTGGATAGTTGGAGAAGGAGG + Intergenic
1201714483 Y:17029442-17029464 AGGTGGATAGGTAGGTAAGTAGG - Intergenic