ID: 1050435902

View in Genome Browser
Species Human (GRCh38)
Location 9:5610576-5610598
Sequence GTTCTCAGTGAAGCACAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050435898_1050435902 1 Left 1050435898 9:5610552-5610574 CCATGGGTAACTGCCACAAATTG No data
Right 1050435902 9:5610576-5610598 GTTCTCAGTGAAGCACAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050435902 Original CRISPR GTTCTCAGTGAAGCACAGTC TGG Intergenic
No off target data available for this crispr