ID: 1050437853

View in Genome Browser
Species Human (GRCh38)
Location 9:5628956-5628978
Sequence GAGGGCCCGCGCGCGCGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050437853_1050437857 -4 Left 1050437853 9:5628956-5628978 CCAGAGCGCGCGCGCGGGCCCTC 0: 1
1: 0
2: 0
3: 17
4: 147
Right 1050437857 9:5628975-5628997 CCTCCCCGGCCCGACCCACGCGG 0: 1
1: 0
2: 2
3: 17
4: 209
1050437853_1050437868 27 Left 1050437853 9:5628956-5628978 CCAGAGCGCGCGCGCGGGCCCTC 0: 1
1: 0
2: 0
3: 17
4: 147
Right 1050437868 9:5629006-5629028 GGTGACGCCCGCGCGGCCTGAGG 0: 1
1: 0
2: 0
3: 4
4: 87
1050437853_1050437867 20 Left 1050437853 9:5628956-5628978 CCAGAGCGCGCGCGCGGGCCCTC 0: 1
1: 0
2: 0
3: 17
4: 147
Right 1050437867 9:5628999-5629021 GCGGCGTGGTGACGCCCGCGCGG 0: 1
1: 0
2: 0
3: 8
4: 55
1050437853_1050437861 1 Left 1050437853 9:5628956-5628978 CCAGAGCGCGCGCGCGGGCCCTC 0: 1
1: 0
2: 0
3: 17
4: 147
Right 1050437861 9:5628980-5629002 CCGGCCCGACCCACGCGGCGCGG 0: 1
1: 0
2: 1
3: 11
4: 124
1050437853_1050437864 6 Left 1050437853 9:5628956-5628978 CCAGAGCGCGCGCGCGGGCCCTC 0: 1
1: 0
2: 0
3: 17
4: 147
Right 1050437864 9:5628985-5629007 CCGACCCACGCGGCGCGGCGTGG 0: 1
1: 0
2: 0
3: 13
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050437853 Original CRISPR GAGGGCCCGCGCGCGCGCTC TGG (reversed) Intergenic