ID: 1050438042

View in Genome Browser
Species Human (GRCh38)
Location 9:5629618-5629640
Sequence CTGGAGGACGTGCCTGCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050438042_1050438046 -10 Left 1050438042 9:5629618-5629640 CCGGCTGCAGGCACGTCCTCCAG 0: 1
1: 0
2: 1
3: 18
4: 247
Right 1050438046 9:5629631-5629653 CGTCCTCCAGCCGGCGGTCCGGG 0: 1
1: 0
2: 2
3: 16
4: 129
1050438042_1050438049 -6 Left 1050438042 9:5629618-5629640 CCGGCTGCAGGCACGTCCTCCAG 0: 1
1: 0
2: 1
3: 18
4: 247
Right 1050438049 9:5629635-5629657 CTCCAGCCGGCGGTCCGGGGTGG 0: 1
1: 0
2: 1
3: 12
4: 115
1050438042_1050438047 -9 Left 1050438042 9:5629618-5629640 CCGGCTGCAGGCACGTCCTCCAG 0: 1
1: 0
2: 1
3: 18
4: 247
Right 1050438047 9:5629632-5629654 GTCCTCCAGCCGGCGGTCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050438042 Original CRISPR CTGGAGGACGTGCCTGCAGC CGG (reversed) Intronic
900241077 1:1617798-1617820 CGGGAGCAGTTGCCTGCAGCGGG + Intronic
901080414 1:6580743-6580765 CTGGAAAAAGTGACTGCAGCAGG - Exonic
901764591 1:11491778-11491800 CTTGGGGACCTGCCTACAGCAGG + Intronic
902304671 1:15526915-15526937 CTGGAGCACGGAGCTGCAGCCGG + Exonic
902338553 1:15767794-15767816 CTGAAGGAGGTGTCTGCGGCAGG - Intronic
903070889 1:20726601-20726623 CAGCAGGACGAGCCTGCAGCAGG + Intronic
905964555 1:42081204-42081226 CTGGTGGTGGTGGCTGCAGCAGG + Intergenic
906083296 1:43108074-43108096 CTGGAGGAGGGGCCTGCTGGTGG - Intergenic
907092069 1:51734438-51734460 GTGGAGGACTTGGCTGCAGTTGG + Intronic
907255493 1:53175610-53175632 CTGCAGGACAGGCCAGCAGCTGG - Intergenic
908819349 1:68067387-68067409 CTGGAGGTGGGGCCTGAAGCTGG + Intergenic
910684472 1:89902205-89902227 CTGGAAGATGCTCCTGCAGCAGG + Intronic
914458111 1:147855513-147855535 CTGGAGGAGGTGCCTTGAGGAGG - Intergenic
915217386 1:154349281-154349303 CTGGTGGAAGGGCCTACAGCTGG - Exonic
916787959 1:168099785-168099807 CTGGAGGACGTGGCTGTACATGG - Intronic
917073925 1:171183666-171183688 CTGGAGGTCGAGACTGCAGTGGG - Intergenic
917854870 1:179091893-179091915 CTGGAAGGCCTTCCTGCAGCAGG + Intronic
918816989 1:189199361-189199383 CTGGAGAACATGCCTGTAACGGG - Intergenic
920132242 1:203741268-203741290 CTGGAGCATGTGGCTGAAGCGGG - Exonic
920177046 1:204108530-204108552 CTGGAGGCTGTGGCTGCTGCTGG + Intronic
920183135 1:204144793-204144815 CTGGAGGAGATGGCTGGAGCAGG - Intronic
920940676 1:210479024-210479046 CTGGTGGAGGTGCCAGCAGCAGG + Intronic
922770064 1:228176834-228176856 CGGGAGGAAGCGGCTGCAGCTGG + Exonic
923128179 1:231050653-231050675 CTGAAGGACCTGCCTGAGGCTGG + Intergenic
923192336 1:231631410-231631432 CTGAAGGACCTGCCTGAGGCGGG - Intronic
923405867 1:233659374-233659396 CTGAAGGACTTTCCTGAAGCTGG + Intronic
923405870 1:233659458-233659480 CTACAGGACTTGCCTGAAGCTGG - Intronic
1062946718 10:1466986-1467008 CTGAAGGACCGGCCTTCAGCAGG + Intronic
1063043525 10:2368503-2368525 CTGGAGGATGTGCAAGCAGCGGG + Intergenic
1064031092 10:11883349-11883371 CTGGAGGGCAGGCCTGAAGCTGG + Intergenic
1067147359 10:43703168-43703190 CTGGAGGACCTCCCTGCGCCCGG - Intergenic
1067562758 10:47315284-47315306 CTGGAGGCCATGCCCACAGCTGG - Intergenic
1067565281 10:47331701-47331723 CTGGAGGCCAGGCCTGCTGCAGG - Intergenic
1068795325 10:61072997-61073019 CTCGAGGACCTGCCTGAGGCTGG + Intergenic
1068951190 10:62779194-62779216 CTGGGAGACATTCCTGCAGCTGG + Intergenic
1069832263 10:71288664-71288686 ACGGAGGCCGTGACTGCAGCGGG + Exonic
1070825355 10:79387538-79387560 CTGGAGCCCCTGCCTGCAGAAGG + Intronic
1070943814 10:80371677-80371699 CTGGAGGCGCTGCGTGCAGCAGG + Intergenic
1071182212 10:82999767-82999789 CTGGAGGAGTTACCTGCTGCAGG + Intergenic
1073330973 10:102669633-102669655 CTGGCTGAGGGGCCTGCAGCTGG + Intergenic
1073480597 10:103784039-103784061 CTGGAGAAGTAGCCTGCAGCTGG - Intronic
1073675899 10:105646756-105646778 CTGGAGGAGGTGACTGAAGGTGG + Intergenic
1073793807 10:106966045-106966067 CTGGAGAACTTGGCTGCTGCCGG + Intronic
1074191200 10:111139294-111139316 CAGGAGAAGGTGGCTGCAGCTGG + Intergenic
1076048123 10:127311351-127311373 CTGGAGGATGTTCCTTCTGCAGG - Intronic
1076757213 10:132578835-132578857 CTGGAGGGGGTGCCAGCAGAGGG + Intronic
1076982729 11:213430-213452 GAGGAGGAGGGGCCTGCAGCTGG + Intronic
1077071173 11:674067-674089 CTGAAGAACGTGCCAGAAGCTGG + Intronic
1077494508 11:2880372-2880394 GTGGAGAAAGCGCCTGCAGCAGG + Intergenic
1078714511 11:13827119-13827141 CTGGAAGGCTTGCCTGCAGCTGG + Intergenic
1080652544 11:34234193-34234215 CTGGAGGAGGTGCCTAAAGCAGG + Intronic
1081435871 11:43026845-43026867 TTGGAGCACATGCCTGCACCTGG + Intergenic
1083868030 11:65468989-65469011 CAGGAGGCCCTGCCTGCAGGTGG - Intergenic
1089048108 11:115521322-115521344 CTGGAGGAGGAGCCTGAAGATGG - Intergenic
1090226899 11:125077101-125077123 CAGGAGGAGGTGCCAGTAGCGGG + Intronic
1091956897 12:4652491-4652513 CTGGAGGATGTGGCTGTAGGTGG - Intronic
1093789955 12:23237493-23237515 TTGGAGGAGGTCCCAGCAGCTGG + Intergenic
1094406205 12:30118951-30118973 CTGTAGGGCGGGCCTGCGGCTGG - Intergenic
1097130845 12:56809861-56809883 CAGGATGACCTGCCTGCAGAGGG - Intergenic
1098893410 12:76031763-76031785 CTGGAGGGCGTGGACGCAGCGGG - Exonic
1103054175 12:117805651-117805673 CTGGAGGATGTTGCTGCTGCTGG - Intronic
1104745148 12:131205773-131205795 AAGGAGGACGTGGGTGCAGCAGG - Intergenic
1104789250 12:131471626-131471648 ATGGAGGACGTGGATGGAGCAGG + Intergenic
1104984142 12:132587197-132587219 CTGGAGGACGGCAGTGCAGCTGG + Intergenic
1113767881 13:112892272-112892294 CTGCAGGACGTGCAAGCAGATGG - Intergenic
1113813851 13:113158589-113158611 CTGGGGGAGGTGCCGGCAGCAGG - Intergenic
1114674830 14:24432712-24432734 CTGGAGGCCATGCCTGTAGTGGG - Exonic
1117530134 14:56652878-56652900 CTGGAGGAACTGCCTCCAGGTGG - Intronic
1117743692 14:58845669-58845691 CTGGAGGTGGTGTCTTCAGCAGG + Intergenic
1118636890 14:67756133-67756155 CTGGAGGACTCTCCTGGAGCAGG + Exonic
1120910646 14:89663721-89663743 CTTGAGGACGTGCAGGGAGCTGG + Intergenic
1121324756 14:93013412-93013434 CAGGAGGCCGTGCCTGCTTCTGG - Intronic
1121327294 14:93028663-93028685 CTTGGGGAGGTGCCTGCAGGGGG - Intronic
1121571431 14:94949572-94949594 CTGGGGGAGGGGCCTGCAACTGG - Intergenic
1121571976 14:94953061-94953083 CTGGGGGAGGGGCCTGCAACTGG - Intergenic
1122258500 14:100498579-100498601 GTGGAGGTGGTGCCAGCAGCAGG - Intronic
1122290403 14:100677764-100677786 CTGGAGGAAGTGCCTGTAAGCGG + Intergenic
1122628733 14:103097802-103097824 CTGGAGGCTGGGCGTGCAGCCGG + Intergenic
1123398681 15:19962921-19962943 CTGGAGGAAAAGCCTGCATCGGG + Intergenic
1124291443 15:28456459-28456481 CTGGGGGTCCTGCCTGGAGCAGG - Intergenic
1125238847 15:37550090-37550112 CTGAATGACCTGCCTGCAGAGGG - Intergenic
1127733343 15:61819798-61819820 CTGGTGGACGTGTGTGAAGCAGG + Intergenic
1128162632 15:65434321-65434343 CTGGACGCTCTGCCTGCAGCTGG + Intergenic
1128424115 15:67521802-67521824 CCCGAGGACGCGCCCGCAGCAGG - Intronic
1128995030 15:72289362-72289384 CTGGGGGCCGTACCTGCCGCGGG + Exonic
1129071994 15:72959475-72959497 CAGGAGGATGTTGCTGCAGCTGG - Intergenic
1132045202 15:98557734-98557756 CTGGAGGAGGGGCCTTAAGCAGG + Intergenic
1132323154 15:100942082-100942104 CAGGAGGTGGTGGCTGCAGCCGG + Intronic
1132539150 16:500182-500204 CTGGAGGAAGTGCTCACAGCAGG + Intronic
1132591106 16:726879-726901 CTGGAGGAGGTGCCAGCGCCGGG + Intronic
1133285846 16:4690347-4690369 CTGGAGGGCTGCCCTGCAGCTGG + Exonic
1133334911 16:5000764-5000786 CTGGACGCCGTGCCTGGGGCCGG + Intronic
1133346774 16:5076371-5076393 ATGGAGGACTGGCATGCAGCAGG - Intronic
1134805581 16:17121385-17121407 TTGGAGGATGTGACAGCAGCAGG - Intronic
1136294790 16:29295338-29295360 CTGGTGGCCGGGCCTACAGCAGG + Intergenic
1137676201 16:50304987-50305009 TTGGAGGAGGTGGCTGCAGCAGG - Intronic
1138563093 16:57813752-57813774 CTGCAGCACGTGCCTTCAGAGGG + Intronic
1140475588 16:75237984-75238006 CCGGGGGAGCTGCCTGCAGCAGG + Intronic
1141823302 16:86462616-86462638 GTGGGGGACGTGGCAGCAGCCGG - Intergenic
1141955021 16:87364931-87364953 CAGGAGGTCGAGCCTGCAGTGGG + Intronic
1142025568 16:87811231-87811253 CGGGAGGAAGTACTTGCAGCAGG - Intergenic
1142031338 16:87839985-87840007 CAGGAGGCTGTGCCTGGAGCGGG + Intronic
1142621564 17:1168746-1168768 CCGGAGGACCTTGCTGCAGCTGG - Intronic
1143451273 17:7038309-7038331 CTGGAGGGGGTCCCTGCTGCTGG + Exonic
1144951376 17:18996268-18996290 CTGGAGGAGGGGGTTGCAGCTGG - Intronic
1147646554 17:42037870-42037892 CCGGAGGCCGGGCCTGCTGCAGG + Exonic
1147690438 17:42311681-42311703 CTGGAGGTGGGGCCTGGAGCAGG + Exonic
1148153408 17:45409729-45409751 GTGGAGGGCGTGACTGCACCTGG - Intronic
1148353104 17:46955673-46955695 CTGGAGGAGGTGAGTGCAGAAGG - Intronic
1151492309 17:74439933-74439955 CTGGAGGCCGTGGCTGGGGCGGG + Exonic
1152028201 17:77825307-77825329 CTGGAGGATGTGCATTCAGTGGG - Intergenic
1152217749 17:79044253-79044275 CTGCAGGACCAGCCTCCAGCAGG - Intronic
1152343034 17:79735678-79735700 CTGGAGGTGGTGCCTCCAGCAGG - Intronic
1152420686 17:80191445-80191467 CCGGAGGCTCTGCCTGCAGCTGG - Exonic
1152875183 17:82782345-82782367 CTGGAGGGGGAGCCGGCAGCCGG + Intronic
1154212813 18:12394597-12394619 CTGGAGGGCATGCCAGCAGAGGG + Intergenic
1154330031 18:13421847-13421869 CTGGGGGACGGGCCTGGGGCTGG + Intronic
1156357865 18:36358375-36358397 GTGGAGGAAGTGCCAGCATCTGG - Intronic
1160521885 18:79512565-79512587 CAGGAGGAGATGCCTGCAGTCGG + Intronic
1160630688 18:80245211-80245233 CTGGAGGACATGCCCTCACCAGG - Intronic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1164443720 19:28299787-28299809 CTGGAGGAAGTGCTTTCAGGAGG - Intergenic
1164483785 19:28637451-28637473 CTGGAGGAATTTCCTGCAGAGGG - Intergenic
1164804331 19:31104626-31104648 CTGGAGCAAGTCCCTTCAGCAGG + Intergenic
1167360948 19:49030065-49030087 TTGGGTGAGGTGCCTGCAGCTGG + Intronic
1167362707 19:49038732-49038754 TTGGGTGAGGTGCCTGCAGCTGG - Intergenic
1167363433 19:49042457-49042479 TTGGGCGAGGTGCCTGCAGCTGG + Intergenic
1167365064 19:49050470-49050492 TTGGGCGAGGTGCCTGCAGCTGG - Intergenic
1167367312 19:49061615-49061637 TTGGGCGAGGTGCCTGCAGCTGG - Exonic
925027265 2:619957-619979 CAGGAAGAGGGGCCTGCAGCAGG + Intergenic
926152601 2:10433124-10433146 CCGGAGGGCCTGGCTGCAGCTGG - Intergenic
926889857 2:17629677-17629699 GTGGACGAGGTGCCTCCAGCAGG - Intronic
929856513 2:45642671-45642693 CTGGAGGCGATGCCTGCAGTGGG + Intergenic
929896191 2:45962749-45962771 CTGGGAGAAGTGCCAGCAGCGGG + Intronic
930189576 2:48443532-48443554 CGGGAGGATGTGCCTGGAGGAGG + Intronic
930872563 2:56183946-56183968 CTGGAGGAGGAGCCTGGAGCTGG - Intergenic
933396081 2:81733048-81733070 CAGGAGGAAGTACCTGCAGTGGG + Intergenic
934779327 2:96959832-96959854 TTAGAGCATGTGCCTGCAGCTGG + Intronic
935602641 2:104938662-104938684 CTGGAGGCTGCCCCTGCAGCGGG - Intergenic
938959126 2:136325091-136325113 CTGGAGGAGGTGACTCCAGGTGG + Intergenic
940954391 2:159712273-159712295 CTGGCCGGCGTGCCGGCAGCTGG - Intergenic
944535359 2:200704370-200704392 CTGGAGGCAGTGCCTGTTGCTGG + Intergenic
945955376 2:216081731-216081753 CAGGAGGCCATCCCTGCAGCGGG + Exonic
946937217 2:224734835-224734857 CTGGAGGAGGTGCCTGGTGGGGG - Intergenic
947012472 2:225582068-225582090 CCGGAGGACGTCGCTGCCGCGGG + Exonic
948824037 2:240565839-240565861 GTGGAGGGCTTGCCTGCCGCTGG + Intronic
1168957650 20:1845856-1845878 CTGGAGGAAGGGCCAGCAGGAGG + Intergenic
1170662883 20:18360092-18360114 CTGGAGGACAAGCCTGAGGCTGG - Intergenic
1171013960 20:21523291-21523313 CTGGGGGAGGAGCCTGGAGCCGG - Intergenic
1171041045 20:21763825-21763847 CTGGAGGATCTGCCTCCAGGAGG - Intergenic
1172390010 20:34559726-34559748 CTGCAGGCGGCGCCTGCAGCCGG - Exonic
1172522801 20:35579186-35579208 CTGGTGGACGTGGCTCCAGAGGG - Intergenic
1172673858 20:36653613-36653635 CTGGAGAAAGTCCCTTCAGCCGG - Exonic
1175741082 20:61420213-61420235 CAGGAGGAGCTGCCTGCAGAGGG - Intronic
1175827026 20:61941978-61942000 CTGGACCACATGCCTGCAGAAGG - Intergenic
1175910107 20:62401229-62401251 CTGAAGGAGGTGCCTGCACATGG + Intronic
1175963032 20:62646590-62646612 CTGCAGGCCCTGCCTGCCGCAGG - Intronic
1175993116 20:62799266-62799288 CCTGAGGACCTGCCTGCGGCGGG - Intronic
1178444852 21:32630199-32630221 CAGGAGGAGGTTCTTGCAGCTGG - Intronic
1179647852 21:42786141-42786163 CTGGAGGAAGCGGCTGTAGCAGG + Intergenic
1180183856 21:46129951-46129973 CTGGAGGATGTTCCAGCACCAGG + Intronic
1180752314 22:18132950-18132972 CCAGAGGTCGTGCCTGCACCAGG + Intronic
1181441120 22:22935643-22935665 CTGGTGGCCCTGCCTGCAGCTGG + Intergenic
1181545071 22:23598048-23598070 CCGGTGGCCCTGCCTGCAGCTGG - Intergenic
1181815239 22:25431834-25431856 CTGGTGGCCCTGCCTGCAGCTGG + Intergenic
1182286971 22:29254387-29254409 CTGGAGAAGGTGCCTGCCCCAGG + Intronic
1182473462 22:30562593-30562615 CTGGTAGGCTTGCCTGCAGCGGG - Intronic
1184775270 22:46619977-46619999 ATGAAGGGCGTGCCAGCAGCCGG + Intronic
952486016 3:33810959-33810981 CTGGAGGTCATGGCTGCAGTGGG - Intronic
953289763 3:41649517-41649539 CCGGAGGAGGTGCCAGGAGCAGG - Intronic
953775816 3:45816282-45816304 CTGGAAGACCTGCTAGCAGCTGG - Intergenic
954901369 3:54022798-54022820 TTGGAGGAGGAGCCTGCAGGAGG - Intergenic
954975726 3:54692422-54692444 CTGGATGCTGTGCCTGCAGAGGG + Intronic
955351660 3:58197928-58197950 CTTGGGGACGTAGCTGCAGCCGG + Exonic
957614544 3:82509844-82509866 CTGGACGACTTGCCTGCAGATGG + Intergenic
959272000 3:104223597-104223619 CTGAAGAACCTGCCTGAAGCTGG - Intergenic
960047530 3:113212134-113212156 CCGGGGGACGTGCCGGCGGCGGG + Intronic
962912780 3:139870068-139870090 CTGGAGGAGGTGCCTCCTGCAGG + Intergenic
963250109 3:143095429-143095451 CTGGAGCAGGTGCCAGGAGCGGG - Intergenic
967720275 3:192808843-192808865 CTGGAGGATGTGACAGCAGCAGG - Intronic
967777190 3:193396612-193396634 GTGAAGAAGGTGCCTGCAGCTGG - Intergenic
968178102 3:196568766-196568788 GCGGAGGACGCCCCTGCAGCCGG + Exonic
968593298 4:1470410-1470432 CTGGAGGAGGGGGCTGCGGCTGG + Intergenic
968774957 4:2535347-2535369 CAGGAGGCTGTGGCTGCAGCTGG + Intronic
969247982 4:5947931-5947953 CTGGAAGAGGTGCCTGCATCTGG - Intronic
970182533 4:13415306-13415328 CTTGAGGAAGTGCCCGCCGCTGG + Intronic
971473966 4:27055432-27055454 CCTGAGGACTGGCCTGCAGCTGG - Intergenic
975195457 4:71518602-71518624 CTGGAGGCTGGGTCTGCAGCTGG + Intronic
977614910 4:99077384-99077406 GCGGAGCACGTGCCTGCAGGAGG + Intronic
978061378 4:104344627-104344649 CTGGAGCATGTGCCAGGAGCAGG - Intergenic
978351571 4:107825203-107825225 CGGGAGCAAGTGCCTTCAGCTGG + Intronic
983408002 4:167355303-167355325 GTGGAGGAAGTACCTGCAGATGG - Intergenic
984923103 4:184783103-184783125 CTGGAGCACGTGCCTGTTCCGGG + Intronic
984988644 4:185355956-185355978 ATGGAGGAAGTGCATGCCGCAGG - Intronic
985064177 4:186105140-186105162 CTGGAGGAGGGGCCTGCGGGGGG - Intronic
985261373 4:188118115-188118137 CTGGAGGGTGTGTCTCCAGCCGG + Intergenic
985437688 4:189947684-189947706 CTGGGGGGAGTGCATGCAGCAGG - Intronic
985631876 5:1018078-1018100 CTGGAGGACGGGACGGTAGCAGG + Intronic
985744308 5:1637707-1637729 CTGGAGGACATGCCTGTGCCAGG - Intergenic
985816999 5:2134578-2134600 CTGGAGGCCATGGCTGCAGGTGG - Intergenic
985863882 5:2496188-2496210 CTGGAGGTGGGGCCTGCAGGAGG + Intergenic
986287460 5:6370506-6370528 ATGGAGGATGTGCCGGCAGTAGG - Intergenic
986796411 5:11216929-11216951 CTGGAGGAGGTGCCTACTGAAGG + Intronic
991999216 5:72418759-72418781 CGGGAGGACGAGCTTGCAGCGGG - Intergenic
998418573 5:141963170-141963192 CTAGGGGACATGCCTGCACCTGG - Intronic
1002095862 5:176830309-176830331 CTGGAGGATGTGCCTCCATGGGG + Intronic
1007090185 6:39179383-39179405 CTGGAGGACTGCCCTACAGCAGG - Intergenic
1007686097 6:43668176-43668198 CTGGAGGCGGTGACAGCAGCTGG + Intronic
1019005975 6:168796335-168796357 TGGGAGGAAATGCCTGCAGCTGG + Intergenic
1019403535 7:869809-869831 CTGGATGACGTGGGAGCAGCTGG + Intronic
1019614841 7:1954521-1954543 CAGGAGGCCGTGGCTGCAGGTGG + Intronic
1021696537 7:23281775-23281797 CTGAAGGACCTGCCTGAGGCTGG - Intergenic
1022259521 7:28690758-28690780 AGGGAGGCCGTACCTGCAGCAGG - Intronic
1024420263 7:49157724-49157746 CTGGAGCAGGTGGCTGCTGCTGG - Intergenic
1025638997 7:63349910-63349932 CGGGAGGTCGTAGCTGCAGCCGG - Intergenic
1025643702 7:63398182-63398204 CGGGAGGTCGTAGCTGCAGCCGG + Intergenic
1030230930 7:107207687-107207709 CTGGAGCACCTGCCTGATGCAGG + Intronic
1031415256 7:121488462-121488484 CAGGAGGACACACCTGCAGCAGG + Intergenic
1031509061 7:122625932-122625954 CTGGAGAACCTGACTACAGCAGG + Intronic
1031624347 7:123974955-123974977 CTGGGGGAAATGACTGCAGCTGG + Intergenic
1033253903 7:139782708-139782730 CTGGAGGATGTGCCTGAGGGAGG + Exonic
1033406525 7:141074634-141074656 CTGGAGGAAGTGCCACCGGCAGG + Exonic
1033843942 7:145409361-145409383 CTGAAGAAAGTGCCTGCAGAGGG + Intergenic
1034412414 7:150948251-150948273 CTGGAGGAGGTGACAGCTGCAGG + Intronic
1034547246 7:151797067-151797089 CTGGAGGGTGTGTCTGCAGCTGG - Intronic
1034893954 7:154863427-154863449 CTGGAGGTCGAGGCTGCAGTGGG - Intronic
1035395566 7:158532712-158532734 CTGGAGGAAGCGCCTGTTGCTGG - Intronic
1035416834 7:158696204-158696226 CTGGAGGATGAGACTGCAGAGGG - Intronic
1035678741 8:1472183-1472205 CTGGAGGAAATCCTTGCAGCAGG + Intergenic
1036967731 8:13319449-13319471 CTGGAGGAGGGGCCTGCTGGCGG + Intronic
1041731603 8:61068689-61068711 CTGGAGGCCTGGCTTGCAGCAGG - Intronic
1044053726 8:87542470-87542492 CAGGATGACCTGCCTGCAGAAGG - Intronic
1045406464 8:101871499-101871521 CTGAAGTAAGTGCCTGCAGATGG - Intronic
1047251045 8:123182418-123182440 CTGGAGGATGGGCCTGAAGGAGG - Exonic
1047308326 8:123671455-123671477 CTGGAAAACAGGCCTGCAGCCGG - Intergenic
1048544477 8:135373722-135373744 CTGGAGGAAGTGCCTGCCTTTGG - Intergenic
1049408536 8:142462300-142462322 CTGCAGGAAGTGCTTCCAGCAGG - Intronic
1049455145 8:142682847-142682869 AAGGAGGACGTCCCTGCAGAGGG + Intergenic
1049477933 8:142805534-142805556 CTTGAGGAGGGGCCTGCAGTGGG - Intergenic
1049812523 8:144581844-144581866 CTGGAGGCTGTGCCCCCAGCGGG - Intronic
1050295252 9:4197579-4197601 CTGGTGCTCGTGCCTGCTGCTGG + Intronic
1050438042 9:5629618-5629640 CTGGAGGACGTGCCTGCAGCCGG - Intronic
1050959641 9:11712153-11712175 CTGGTGCACGTGGCTGCTGCTGG - Intergenic
1052362174 9:27573248-27573270 CTGGTGGAATTGCCTGCATCCGG - Intronic
1058135632 9:101304862-101304884 CTGGAGAGCGTGGCTGCTGCTGG - Intronic
1060881987 9:127123788-127123810 CAGGAGGACAGGCCTGCTGCCGG + Intronic
1061877328 9:133550960-133550982 CTGGAGGAGGTACCTGTGGCTGG - Intronic
1062140656 9:134956138-134956160 CTGGAGGACATGCCTCCTGTAGG - Intergenic
1062514198 9:136924106-136924128 CTGGACCAGGTGTCTGCAGCAGG + Intronic
1062568048 9:137171927-137171949 CAGGAGGAGGCACCTGCAGCAGG + Exonic
1062573312 9:137195285-137195307 GTGGAGGCCGTGCCTGGCGCTGG - Intronic
1203770695 EBV:48582-48604 CTGCTGAACGTGCCTGCCGCGGG + Intergenic
1186036710 X:5430660-5430682 GTGGAGGATGTGCCTTCTGCTGG - Intergenic
1187465756 X:19526173-19526195 CTGGAGGAAAAGCCTGCAGAAGG + Intergenic
1187508338 X:19895434-19895456 CTGGAGGAAGAGCTTGCAGGTGG + Intergenic
1188434925 X:30148810-30148832 CGGGACGACCTGCCTGCAGACGG + Intergenic
1189227367 X:39424088-39424110 CTGGAAGTCATGGCTGCAGCTGG + Intergenic
1189245666 X:39561481-39561503 TTGGAGGATGTGGCTGCAGGAGG - Intergenic
1192989082 X:76429751-76429773 CTGGAGGATGGGGGTGCAGCGGG + Exonic
1193848283 X:86502292-86502314 CTGCAGGAAATGCCTGGAGCTGG + Intronic
1196722002 X:118863232-118863254 ATGGAGGAAGTGCCTGCTGAAGG + Intergenic
1197772608 X:130098830-130098852 CTGTAGGGCCTGCCTGCAGGTGG - Intronic
1198229718 X:134677496-134677518 CTGGAGGAGGTGACAGCCGCTGG + Intronic
1199615118 X:149649952-149649974 CTGGAGGGGCTGCCTGCTGCTGG - Intergenic
1199635499 X:149808361-149808383 CTGGAGGAGGTGCCTGCTGCTGG + Intergenic
1199894021 X:152115371-152115393 CTGGGGGAGGTGCCTGCTGCTGG - Intergenic
1200018485 X:153182516-153182538 CTGGAGGAGGTGCCCACTGCTGG + Exonic