ID: 1050444697

View in Genome Browser
Species Human (GRCh38)
Location 9:5707341-5707363
Sequence ATATGTATTCTGCTGTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050444693_1050444697 18 Left 1050444693 9:5707300-5707322 CCATTCTGTCTTGGAGAATGTTC 0: 1
1: 0
2: 2
3: 26
4: 265
Right 1050444697 9:5707341-5707363 ATATGTATTCTGCTGTTGGGTGG No data
1050444694_1050444697 -4 Left 1050444694 9:5707322-5707344 CCATGTGCATTTGAGAATAATAT 0: 2
1: 6
2: 83
3: 431
4: 1913
Right 1050444697 9:5707341-5707363 ATATGTATTCTGCTGTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050444697 Original CRISPR ATATGTATTCTGCTGTTGGG TGG Intronic
No off target data available for this crispr