ID: 1050452589

View in Genome Browser
Species Human (GRCh38)
Location 9:5798830-5798852
Sequence TACCAAGGAAAACCACAAAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5712
Summary {0: 1, 1: 0, 2: 7, 3: 117, 4: 5587}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050452584_1050452589 28 Left 1050452584 9:5798779-5798801 CCTTAAGCAGAAAAATAATGAAC 0: 1
1: 0
2: 2
3: 54
4: 482
Right 1050452589 9:5798830-5798852 TACCAAGGAAAACCACAAAGAGG 0: 1
1: 0
2: 7
3: 117
4: 5587
1050452585_1050452589 6 Left 1050452585 9:5798801-5798823 CCAACCTGATCAGAAAGTGCACT 0: 1
1: 0
2: 1
3: 8
4: 119
Right 1050452589 9:5798830-5798852 TACCAAGGAAAACCACAAAGAGG 0: 1
1: 0
2: 7
3: 117
4: 5587
1050452587_1050452589 2 Left 1050452587 9:5798805-5798827 CCTGATCAGAAAGTGCACTGGAA 0: 1
1: 0
2: 1
3: 13
4: 110
Right 1050452589 9:5798830-5798852 TACCAAGGAAAACCACAAAGAGG 0: 1
1: 0
2: 7
3: 117
4: 5587

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050452589 Original CRISPR TACCAAGGAAAACCACAAAG AGG Exonic
Too many off-targets to display for this crispr