ID: 1050455941

View in Genome Browser
Species Human (GRCh38)
Location 9:5834075-5834097
Sequence GTGGGCAAGAGCAGGACTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050455941_1050455947 1 Left 1050455941 9:5834075-5834097 CCTATAGTCCTGCTCTTGCCCAC No data
Right 1050455947 9:5834099-5834121 TCTCAGGCTCCTCTGACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050455941 Original CRISPR GTGGGCAAGAGCAGGACTAT AGG (reversed) Intergenic
No off target data available for this crispr