ID: 1050460877

View in Genome Browser
Species Human (GRCh38)
Location 9:5876324-5876346
Sequence GAGGCTACACATGCCTACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050460877_1050460882 17 Left 1050460877 9:5876324-5876346 CCATGGTAGGCATGTGTAGCCTC No data
Right 1050460882 9:5876364-5876386 CAGCTCTGCTGGAGAGGTGCTGG No data
1050460877_1050460880 11 Left 1050460877 9:5876324-5876346 CCATGGTAGGCATGTGTAGCCTC No data
Right 1050460880 9:5876358-5876380 TCACCACAGCTCTGCTGGAGAGG No data
1050460877_1050460879 6 Left 1050460877 9:5876324-5876346 CCATGGTAGGCATGTGTAGCCTC No data
Right 1050460879 9:5876353-5876375 AACACTCACCACAGCTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050460877 Original CRISPR GAGGCTACACATGCCTACCA TGG (reversed) Intergenic
No off target data available for this crispr