ID: 1050461986

View in Genome Browser
Species Human (GRCh38)
Location 9:5885021-5885043
Sequence TGCTCTCGGGTGTCTGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050461972_1050461986 30 Left 1050461972 9:5884968-5884990 CCTGAGAGGGAGCCACACTCAAG No data
Right 1050461986 9:5885021-5885043 TGCTCTCGGGTGTCTGAGGGAGG No data
1050461977_1050461986 6 Left 1050461977 9:5884992-5885014 CCAGCCCGAGGCCAGCAGGCCAC No data
Right 1050461986 9:5885021-5885043 TGCTCTCGGGTGTCTGAGGGAGG No data
1050461979_1050461986 1 Left 1050461979 9:5884997-5885019 CCGAGGCCAGCAGGCCACAGCTC No data
Right 1050461986 9:5885021-5885043 TGCTCTCGGGTGTCTGAGGGAGG No data
1050461980_1050461986 -5 Left 1050461980 9:5885003-5885025 CCAGCAGGCCACAGCTCTTGCTC No data
Right 1050461986 9:5885021-5885043 TGCTCTCGGGTGTCTGAGGGAGG No data
1050461974_1050461986 18 Left 1050461974 9:5884980-5885002 CCACACTCAAGGCCAGCCCGAGG No data
Right 1050461986 9:5885021-5885043 TGCTCTCGGGTGTCTGAGGGAGG No data
1050461978_1050461986 2 Left 1050461978 9:5884996-5885018 CCCGAGGCCAGCAGGCCACAGCT No data
Right 1050461986 9:5885021-5885043 TGCTCTCGGGTGTCTGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050461986 Original CRISPR TGCTCTCGGGTGTCTGAGGG AGG Intronic