ID: 1050461991

View in Genome Browser
Species Human (GRCh38)
Location 9:5885052-5885074
Sequence TGGAGGAAATGGAGGACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 309}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050461991_1050461998 -5 Left 1050461991 9:5885052-5885074 CCTGTGGTCCTCCATTTCCTCCA 0: 1
1: 0
2: 3
3: 25
4: 309
Right 1050461998 9:5885070-5885092 CTCCACCCTCCTGGCTGCTGGGG No data
1050461991_1050461997 -6 Left 1050461991 9:5885052-5885074 CCTGTGGTCCTCCATTTCCTCCA 0: 1
1: 0
2: 3
3: 25
4: 309
Right 1050461997 9:5885069-5885091 CCTCCACCCTCCTGGCTGCTGGG No data
1050461991_1050461995 -7 Left 1050461991 9:5885052-5885074 CCTGTGGTCCTCCATTTCCTCCA 0: 1
1: 0
2: 3
3: 25
4: 309
Right 1050461995 9:5885068-5885090 TCCTCCACCCTCCTGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050461991 Original CRISPR TGGAGGAAATGGAGGACCAC AGG (reversed) Intronic
902376271 1:16031472-16031494 TGGGGGACATGGGGGACCAGGGG + Intronic
902755695 1:18547947-18547969 TGGGGTAAATGGAGAAGCACAGG + Intergenic
904337709 1:29808907-29808929 TGTGGGAAATGGAGGCCCAAAGG - Intergenic
904440481 1:30526507-30526529 TGGAGGACATGGTGGAGCCCAGG + Intergenic
904902621 1:33869419-33869441 TGGAGGAAATGGGTGGGCACGGG + Intronic
905641722 1:39594606-39594628 TGCAGGAGATGGAGGAGCAATGG + Intergenic
906214098 1:44029328-44029350 TGGAGGAAGTGGAGGAGCTGTGG + Intronic
906667756 1:47633541-47633563 TGGGGGAGTTGCAGGACCACTGG - Intergenic
906929611 1:50156254-50156276 TTGAGGAAATGGAGATCCAAAGG - Intronic
907380874 1:54086904-54086926 TGGAGGAAAAGGAGGAATCCTGG + Intronic
909900651 1:81130416-81130438 ACGAGGAAATGGAGGATCAGAGG - Intergenic
910675850 1:89815883-89815905 TGGAGGAAATGGAGCTGGACGGG - Intronic
910727746 1:90356329-90356351 GGGAGGCAAAGGAGGACCAGAGG - Intergenic
911057121 1:93718529-93718551 TTGAGGAAATTGAGGCCCAGAGG - Intronic
911071948 1:93838909-93838931 TGAAGGACATGGAGGTCCACTGG - Intronic
911260082 1:95675277-95675299 TGGAGGCAAGGCAGGACCTCTGG - Intergenic
913564502 1:120058595-120058617 TGGTGGAAATGGAGCCTCACAGG - Intronic
913633628 1:120734969-120734991 TGGTGGAAATGGAGCCTCACAGG + Intergenic
914285089 1:146217944-146217966 TGGTGGAAATGGAGCCTCACAGG - Intronic
914546120 1:148668683-148668705 TGGTGGAAATGGAGCCTCACAGG - Intronic
914620444 1:149401982-149402004 TGGTGGAAATGGAGCCTCACAGG + Intergenic
914850335 1:151309505-151309527 GAGAGGAAATGCAGGACCTCTGG - Intronic
914929238 1:151915674-151915696 TGGAGGAAATGGAGAGCTACAGG + Intergenic
915859084 1:159422809-159422831 TGGGTGAAAATGAGGACCACTGG + Intergenic
915964545 1:160294840-160294862 TGTAGGGAAGGGAGGAGCACTGG - Exonic
916654257 1:166859504-166859526 TGGGGGAAGTGGAGGACAAAAGG + Intronic
917282520 1:173392186-173392208 AGGAGGAAATTGGGGCCCACAGG - Intergenic
918123992 1:181566492-181566514 AGAAGGAAATGCAGGACCATTGG + Intronic
918232280 1:182547386-182547408 GGGAGGTAATGGAGGAGCAGAGG + Intronic
919622353 1:199877049-199877071 TGGAGGTACTGGAGCAACACTGG + Intergenic
920285900 1:204879489-204879511 TGTAGGACAGGGAGGACCAAGGG + Intronic
922219490 1:223547463-223547485 TGGGGGAAATGGAGAGCGACTGG + Intronic
922325452 1:224524186-224524208 ATGTGGAAATGGAGGACGACTGG + Intronic
922631966 1:227124608-227124630 TGAAGGAAGTGGAGCATCACTGG + Intronic
923473627 1:234313472-234313494 TGGAGGTAAGGAAGGAACACAGG - Intronic
1062936826 10:1396503-1396525 GGGAGGAAATGGAGCAGGACAGG - Intronic
1065767979 10:29049729-29049751 TGGATGAAATAGAGGTCCTCAGG - Intergenic
1065831864 10:29621728-29621750 TGTAGGAAATGCAGGGCCAGAGG - Intronic
1066331713 10:34430785-34430807 ATGAGGAAATGGAGGATCACAGG + Intronic
1067342409 10:45416629-45416651 TGGAGGGAATGGAGGAATACTGG + Intronic
1068175712 10:53455405-53455427 TGGAGGATATTGAGTACCTCAGG - Intergenic
1068966711 10:62919113-62919135 TGGTGGAACTGGATGACCGCAGG + Intronic
1069273205 10:66556724-66556746 TGGGGGAAATAGAGGAACATTGG + Intronic
1069947565 10:71998503-71998525 TGCAGGAAGTGCAGGACCTCAGG - Intronic
1070459934 10:76655163-76655185 TGGAGGAACTAGAAGAACACTGG + Intergenic
1072419356 10:95276712-95276734 ATGAGGAAATGGAGGAACAGGGG + Intronic
1073245881 10:102089837-102089859 AGGAGGAAATGGAGGCTCAGAGG - Intergenic
1073707521 10:106001831-106001853 TGGAGGAGGAGGAGGACCATGGG + Intergenic
1074469596 10:113715146-113715168 AGGAGGCAATGGTGGACAACAGG + Intronic
1077383831 11:2259834-2259856 TGGAGGAGAGAGAGGACCATGGG - Intergenic
1077609789 11:3637137-3637159 TGGAGGAGGTGGAGTACCAAGGG - Intergenic
1078433060 11:11302434-11302456 AGGAGGAAAGGGAGGAGCAGTGG - Intronic
1078750934 11:14163249-14163271 TTGAGGAAATGGAGGCTCAAAGG + Intronic
1080634444 11:34111322-34111344 ATGAGGAAGTGGAGGCCCACAGG + Intronic
1081690423 11:45074195-45074217 TGGAGGAGAGAGAGGACCCCTGG - Intergenic
1083084742 11:60131072-60131094 TGTTGGAAATTGAGGATCACTGG - Intergenic
1083599798 11:63939492-63939514 TGGAGGGAATTGAGGCCCAGAGG + Intronic
1083723972 11:64618874-64618896 TGGGGGACATGGAGGGCAACTGG + Intronic
1084106497 11:66984160-66984182 AGGAGGAAATGGAAGCCCAAGGG - Intergenic
1084942083 11:72618301-72618323 TGCAGGAAACGGAGGAGCAAAGG - Intronic
1085849732 11:80106249-80106271 TGGAGAAAATTGAGGGCAACAGG + Intergenic
1085859652 11:80216786-80216808 TGGAGGAAATTCATCACCACTGG + Intergenic
1090012420 11:123057048-123057070 AGGAAGAAATGGAAGCCCACAGG + Intergenic
1090372266 11:126264712-126264734 TTCAGGAAAAGGAGGACAACAGG + Intronic
1090589287 11:128247754-128247776 TTGAGGAAATGGGGAACCAAAGG + Intergenic
1090973449 11:131662324-131662346 CGGAGGAAATGAAAGACCACAGG - Intronic
1091871648 12:3896097-3896119 TGGGGGAAATGTAGGGCCAGAGG + Intergenic
1094085572 12:26587731-26587753 TGGAGGAGATGGAGGAGAAAGGG - Intronic
1094160507 12:27384815-27384837 TGCAGGCCATGGTGGACCACAGG + Intronic
1095407652 12:41885557-41885579 GGGAAGAAATGGGGGTCCACTGG - Intergenic
1095924275 12:47562934-47562956 TGGAGGAAAGGGAGGAAGAGAGG + Intergenic
1096236247 12:49929251-49929273 AGGAGGAAAAGGAGGACCCATGG + Intergenic
1096328729 12:50689798-50689820 TGGAGAATATGGAGGAGCAGTGG + Intronic
1097640253 12:62172527-62172549 TAGAAGAAATGAAGTACCACAGG + Intronic
1098523623 12:71461602-71461624 TTGAGGAAATTGAAGAGCACAGG - Intronic
1098730054 12:74024671-74024693 TGGAGGAGATGGAGGAAGAGGGG + Intergenic
1101869516 12:108553104-108553126 TGGAGCAAATGGATATCCACAGG + Intronic
1102176104 12:110876169-110876191 TGGAGGATATTTAGGACCATGGG - Intronic
1102404049 12:112657063-112657085 TGGAGGAAAGGGAACACTACTGG - Intronic
1102702419 12:114850994-114851016 TGGAGGAAATGCAGGGAAACAGG + Intergenic
1103452973 12:121042504-121042526 TGAATGAAATGGGGAACCACTGG + Intergenic
1104606963 12:130196938-130196960 TGGGGGAGATGGAGGGCCCCTGG + Intergenic
1104928557 12:132326550-132326572 TGGAGGAGCGGGAGGGCCACTGG - Intronic
1107017970 13:35723186-35723208 TAGAGGAAATTCAGGACCTCTGG - Intergenic
1107803471 13:44132170-44132192 TGGAGGAAAGGCTGGAGCACAGG + Intergenic
1107880647 13:44829406-44829428 TGGAGAAGGTTGAGGACCACTGG - Intergenic
1110541300 13:76709515-76709537 TGCAGGAAAAGCAGGAACACTGG + Intergenic
1112314637 13:98350629-98350651 GGGAGGAACTGGAGGAGCACAGG - Intronic
1114480208 14:23028895-23028917 GGTAGGTAATGGAGAACCACTGG - Intronic
1114536338 14:23425365-23425387 TGGAGGAAATGAGGGACGAGAGG - Exonic
1115555465 14:34541925-34541947 TACAGAAAAGGGAGGACCACTGG - Intergenic
1115558443 14:34561168-34561190 TACAGAAAAGGGAGGACCACTGG + Intronic
1117055940 14:51912062-51912084 ATGAGGAAATGGAGGCACACAGG + Intronic
1117102925 14:52369032-52369054 TGAAGGAAATGGGGAACCAAAGG + Intergenic
1118329480 14:64804397-64804419 TGGGGGAAATGGAGGAAAAGAGG + Intronic
1118469797 14:66065320-66065342 TGGAGGAAAGGAAGGAGGACAGG + Intergenic
1118903375 14:70004905-70004927 TGGAGGAAGTGGAGGTCAAAGGG - Intronic
1119140329 14:72261545-72261567 TGCAGGGAATGGAGATCCACTGG + Intronic
1119415758 14:74468158-74468180 GGGAGGAAATGGAGGCACAGGGG - Intergenic
1119768113 14:77203496-77203518 TAGAGGAAATGGAGACACACAGG + Intronic
1202852753 14_GL000225v1_random:31320-31342 TGGAGGAGATTCAGGACCCCGGG + Intergenic
1124028775 15:25990282-25990304 TGGGGGAAATGGGGGACAACTGG - Intergenic
1125121292 15:36161697-36161719 TAGAGGAGATGTAAGACCACAGG - Intergenic
1125673022 15:41486903-41486925 TGGAGAAGAAGGAGGATCACAGG + Intergenic
1126710231 15:51446868-51446890 AGGAGGAAAAGGAGGACCAAAGG - Intergenic
1127427080 15:58867290-58867312 TGGAAGAAAGGAAGGACCCCCGG - Intronic
1127776456 15:62267776-62267798 AGGAGGAAACTGAGGACCAGTGG + Intergenic
1128862121 15:71082849-71082871 GGGAGGAAAATGAGGACCTCAGG + Intergenic
1131506844 15:93026879-93026901 TGATGGAAATGCAGGACCTCTGG - Exonic
1132089395 15:98935666-98935688 TGGAGGGAATGCAGGAACAAAGG - Intronic
1132462360 16:61797-61819 TCGAGGACATGGACGACCACAGG - Exonic
1132727058 16:1343461-1343483 TGGAGGACATGCAGGCACACTGG + Exonic
1132830995 16:1928229-1928251 TGGGGGAAGGAGAGGACCACTGG + Intergenic
1133483400 16:6194210-6194232 AGGAGGTAATGCAGGACCTCAGG - Intronic
1134090033 16:11386640-11386662 TGGAGCAAATAGAGTCCCACAGG + Intronic
1134118456 16:11567023-11567045 CGGAGGAAATGAAGGACTCCAGG - Intronic
1134219850 16:12345322-12345344 GGGAGGAAACTGAGGCCCACAGG - Intronic
1134875381 16:17693590-17693612 TGGAGGCTCTGGAGGACCAGGGG + Intergenic
1135019414 16:18951093-18951115 TGGCATAAATAGAGGACCACAGG - Intergenic
1136413551 16:30090845-30090867 GGGAGGGAATGGAGGGCCTCTGG + Exonic
1136482013 16:30547998-30548020 TGGAGGAACCAGAGGCCCACAGG + Intronic
1136716393 16:32286877-32286899 TGGAGGAGATGGAGGAGAAGGGG - Intergenic
1136834779 16:33493155-33493177 TGGAGGAGATGGAGGAGAAGGGG - Intergenic
1138230912 16:55335476-55335498 AGGGGGAAAAGGAGGACCAATGG + Intergenic
1138537382 16:57667199-57667221 AGGAGGAAATGGAGGCCAGCAGG + Intergenic
1139724760 16:68888216-68888238 AGGAGAGAATGGAGAACCACTGG - Intronic
1139944632 16:70631828-70631850 ATGAGGAAATGAAGGACCAGAGG - Intronic
1141277903 16:82604757-82604779 AGGGGGAAATGGTGGGCCACTGG - Intergenic
1141813179 16:86390216-86390238 TGGAGGAAGTGGAGGAACCAAGG + Intergenic
1203010024 16_KI270728v1_random:230877-230899 TGGAGGAGATGGAGGAGAAGGGG + Intergenic
1203144949 16_KI270728v1_random:1793443-1793465 TGGAGGAGATGGAGGAGAAGGGG - Intergenic
1142637421 17:1266776-1266798 TGTAGGACGTGGAGGGCCACAGG + Intergenic
1142902147 17:3018707-3018729 TTGAGGAAAAGGAGGCCCGCTGG + Intronic
1143151042 17:4807684-4807706 TGGAAGAGATGGAGGACCTGCGG + Intronic
1143175505 17:4952765-4952787 AGGAGGAATTGGAAGATCACAGG - Intronic
1144208015 17:12992953-12992975 TCGAGGAGATGGAGGAGCGCAGG - Exonic
1146831071 17:36070043-36070065 ATGAGAAAATGGAGGCCCACGGG + Intronic
1147632760 17:41942715-41942737 TGGAGGACTTGGAGAACCATAGG + Intronic
1148733728 17:49852729-49852751 TGGGGGAAAAGGAGGAACCCAGG + Intergenic
1148866239 17:50630207-50630229 TGGAGGAAATGGGGCACGATGGG + Intergenic
1149301677 17:55310147-55310169 TGGAGGAAAGGGTGGAACAAAGG - Intronic
1150741167 17:67780028-67780050 TGGGGGAAAGGGAGTAGCACAGG + Intergenic
1154465734 18:14641653-14641675 TGGGGTAAATGGAGGGCGACAGG - Intergenic
1156498681 18:37543238-37543260 AGGAAGAAATGGAGCTCCACAGG + Intronic
1156580410 18:38368503-38368525 TGGAGGAACTGGAGCACCTGAGG - Intergenic
1157575085 18:48738348-48738370 TGGATGAAATTGGGAACCACTGG - Intronic
1157597909 18:48875040-48875062 AGGAGGAGATGGAGGGCCCCGGG + Intergenic
1157698654 18:49745328-49745350 TGGAGGGAAGGCAGGACCAAAGG + Intergenic
1157719030 18:49909251-49909273 AGGAGGAAATAGAAGACCCCAGG + Intronic
1157885982 18:51367004-51367026 TGGAGAAAATAGAGGACATCAGG + Intergenic
1159877387 18:73827625-73827647 TGGAGGAAAAGGAGGAGGAGAGG + Intergenic
1161263087 19:3348321-3348343 ATGAGGAAATTGAGGCCCACAGG - Intergenic
1162257477 19:9502526-9502548 TGGAGGATATTGAGAAACACTGG + Intergenic
1162839951 19:13349162-13349184 ATGAGGAAACGGAGGCCCACAGG - Intronic
1164778323 19:30872122-30872144 GGAAGGAAATGCAGGGCCACTGG - Intergenic
1164912872 19:32026667-32026689 TGGAGGAGACAGAGGACCATGGG - Intergenic
1166242006 19:41500678-41500700 CGGAGGAAAGGGAGGAGCTCAGG + Intergenic
1166275580 19:41751256-41751278 GGGAGGAAATGGAGCAAAACAGG + Intronic
1166827621 19:45619193-45619215 TGGTGGAAAGGGAGGACAGCAGG + Intronic
1167290122 19:48619860-48619882 TGGGGGGAATGGAGGCCCAAAGG + Intronic
1168089748 19:54074755-54074777 GGGAGGAAGTGGAGGAACAGAGG - Intronic
925113298 2:1354322-1354344 TGGGGGAAGTGGAAGACCCCGGG + Intronic
925601084 2:5609355-5609377 TGGAGGAAAGGGAGGGGCTCAGG - Intergenic
925955948 2:8964061-8964083 AGGAGGTAATGGAGAACGACAGG + Intronic
926732155 2:16043823-16043845 TGGAGGACAAGGAGCCCCACTGG + Intergenic
926786585 2:16524037-16524059 TGGAGGGAAAGGAGGAAGACAGG - Intergenic
927985564 2:27408375-27408397 GGGAGGAAAGGGAGGAAGACGGG - Intronic
928995222 2:37282292-37282314 AAGAGGATATGGAGTACCACTGG + Intronic
930007477 2:46909654-46909676 TGCAGGGACTGAAGGACCACAGG + Intronic
930123574 2:47779626-47779648 GGGAGGAAATGGAGGTTCAGAGG - Intronic
933247063 2:79987281-79987303 AGGAAGATATGGAGGAACACGGG - Intronic
934653005 2:96103159-96103181 TGGAGGGAAAGGAGGTGCACTGG + Intergenic
935319423 2:101871583-101871605 TGGAGGAAGTGGAGGAGGAATGG - Intronic
935799444 2:106678921-106678943 TGAAGGAGATGGAAGACCAGAGG - Intergenic
936517010 2:113187320-113187342 AGGAGGTATAGGAGGACCACAGG - Intronic
936517546 2:113192005-113192027 AGGAGGTACAGGAGGACCACAGG + Intronic
936573035 2:113632274-113632296 TGAAAGAAATGGGGGACCACTGG + Intronic
937220029 2:120337382-120337404 TGCAGGAGATGGAGGGCCAACGG - Intergenic
937470288 2:122168588-122168610 TGGAGAAAATGGAGGCTCAGAGG - Intergenic
937957552 2:127430133-127430155 TGGAGAATCTGGAGGGCCACTGG - Intergenic
938955238 2:136291269-136291291 TGTAGGAAAAAGAGGCCCACTGG + Intergenic
941328869 2:164151456-164151478 TGGAGAAAGTTGAGGACCACTGG - Intergenic
944361481 2:198862457-198862479 TGAAGGAGCTGGAGGCCCACTGG - Intergenic
944512154 2:200475438-200475460 TGGAGGCAAAGGCGGACAACTGG + Intronic
944868466 2:203885141-203885163 AGGAGGAAATGGAGACCCAGAGG - Intergenic
946431726 2:219629974-219629996 TGGAGGAAAGGGGGAGCCACGGG + Intronic
946556999 2:220869675-220869697 TGGAGGAAATGGAAGAAGTCTGG - Intergenic
948183590 2:236001758-236001780 TGGAAGAACTGGAGACCCACGGG - Intronic
948491122 2:238314045-238314067 TGGAGCAAATGCATGTCCACTGG - Intergenic
1171522527 20:25786652-25786674 ATGAGGAAACGGAGGCCCACAGG - Intronic
1171530275 20:25848612-25848634 ATGAGGAAACGGAGGTCCACAGG - Intronic
1171554300 20:26069231-26069253 ATGAGGAAACGGAGGCCCACAGG + Intergenic
1172658340 20:36550078-36550100 TGTGGGAAAGGGAGGACCATGGG + Exonic
1172871165 20:38136334-38136356 TAGAGGAGAGGGACGACCACTGG + Intronic
1173184558 20:40830691-40830713 TGGAGGAAATGGAGCAACATGGG + Intergenic
1173498263 20:43534366-43534388 TGGAGGATGTGGAGGACCATCGG + Exonic
1173547373 20:43909217-43909239 TGCAGAAAATGGAAGTCCACAGG - Intergenic
1173810572 20:45952732-45952754 AGGAGAAGATGGAGGGCCACAGG + Intronic
1175109617 20:56637985-56638007 TGGAGAAAATGGAGAAACACAGG + Exonic
1176009008 20:62881807-62881829 TAGAGGAAGAGGAGGACGACAGG - Exonic
1176656331 21:9591628-9591650 ATGAGGAAACGGAGGTCCACAGG - Intergenic
1176808855 21:13516937-13516959 TGGGGTAAATGGAGGGCGACAGG + Intergenic
1178793209 21:35719402-35719424 TGGAGGAAAAGGAGGTCTCCAGG + Intronic
1179071196 21:38072709-38072731 TGGAGGAGGGGGAGGACCACAGG + Intronic
1179229079 21:39484601-39484623 TGGAAGAAAGGGATGGCCACAGG + Intronic
1180802340 22:18637770-18637792 TGGAGGCAATGGGGCCCCACTGG - Intergenic
1181219384 22:21357491-21357513 TGGAGGCAATGGGGCCCCACTGG + Intergenic
1181837606 22:25623784-25623806 TGGTGGAAATGGAGGATGATGGG - Intronic
1183539663 22:38422823-38422845 TGGAAGAAAAGGAGGAAGACAGG - Intergenic
1183652733 22:39168027-39168049 TGGAGGGAAAGGAGGAGCAGAGG + Intergenic
1184225569 22:43127402-43127424 TGGTGGAAATGGTGGACAAGGGG - Intronic
1184340318 22:43882233-43882255 TGGAGGCAGTGGGGAACCACGGG - Intronic
1184512352 22:44941136-44941158 CTGAGGAAATGGAGGATCAGAGG + Intronic
1185427154 22:50778600-50778622 TGAAAGAAATGGGGAACCACTGG - Intronic
949379512 3:3429435-3429457 TGGAGCAAGGGGAGGAGCACTGG + Intergenic
949795751 3:7848814-7848836 TGGAAGAGATGGAGCTCCACAGG + Intergenic
950194531 3:10999837-10999859 TGGGGGAAATGGAGGAGGAGAGG - Intronic
950572804 3:13812346-13812368 TGGAGGAGCTGGAGGACAAGCGG - Intergenic
950984646 3:17348416-17348438 TGGTGGAAATGCAGAACCCCAGG - Intronic
951380569 3:21979191-21979213 AGGAGGATATGGGGGACCATGGG + Intronic
953272265 3:41457324-41457346 TGGAGGATCTGGAGGACCATGGG - Intronic
953381533 3:42476290-42476312 TGGAGGGAGTAGAGGACCACAGG + Intergenic
956483174 3:69693513-69693535 GGAAGGAAATGGAGGCCCAGAGG + Intergenic
960163960 3:114380816-114380838 TGGAGTAATGGGAGGAGCACTGG + Exonic
960553156 3:118999030-118999052 TGTAGGAAATGGGGGTGCACTGG + Intronic
961817013 3:129556260-129556282 TGGGAGAAATGGACGCCCACTGG - Exonic
963765391 3:149329665-149329687 TGGTAGAAATGCAGGAGCACTGG + Intronic
964225734 3:154399163-154399185 TGGAGGAGGTTGAGAACCACTGG + Intronic
964249615 3:154697541-154697563 TTGTGGAAATGGCTGACCACAGG - Intergenic
964305035 3:155330515-155330537 GGGAGGATATTGAGGACAACAGG + Intergenic
966097509 3:176221401-176221423 TGTAGGAAATGGAGACACACCGG + Intergenic
967073754 3:185983914-185983936 GGAAGGAAAGGGAGGACCAAGGG + Intergenic
967201990 3:187079835-187079857 CCAAGGAAATGGAGGGCCACAGG + Intergenic
967279823 3:187811113-187811135 AGGAGGAAATGGAGGTTCAGTGG + Intergenic
968505845 4:971188-971210 TGGGGGAACTCGAGGACCACAGG - Intronic
970510777 4:16779569-16779591 TGGAGAAAATGAAGGGCCATAGG + Intronic
970577647 4:17443746-17443768 TGGCGCAAATGAAGGACTACAGG + Intergenic
972394106 4:38643343-38643365 TGGAGGAGATGGAAGAGAACTGG + Intergenic
972397580 4:38671218-38671240 ATGAGGAAATGGAGGAACAGAGG - Intronic
974149887 4:57992996-57993018 TGGAGGACATGTGGGGCCACTGG + Intergenic
975089343 4:70382849-70382871 AAGAGGAAATGGTGCACCACAGG + Intronic
976457719 4:85267971-85267993 GGGAGGAAAGGGAGGAACATGGG + Intergenic
979311631 4:119210730-119210752 TGGAGGAACTGGAGGAAGAATGG + Intronic
979426916 4:120579081-120579103 CGTAGGTAATGGAGGAACACGGG - Intergenic
979476541 4:121164943-121164965 TTGAGGTAATGGAGCACTACTGG + Intronic
979919765 4:126481232-126481254 TGGAGGAAAAGCAGTACCAGTGG + Intergenic
986148157 5:5099543-5099565 TGGGGTAAATGGAAGACAACTGG - Intergenic
986846367 5:11760299-11760321 TGGAGTAGATAGATGACCACAGG - Intronic
987868586 5:23579778-23579800 TGGATGAACTGGAGGATCAAAGG - Intergenic
988508146 5:31842162-31842184 GGGATGAAATGGAGGAGAACTGG - Intronic
990295820 5:54400459-54400481 TGGTGGAGAGGGAAGACCACAGG + Intergenic
990956422 5:61344642-61344664 TGGAGGAAGAGGGGGACAACTGG - Intronic
991582217 5:68168159-68168181 ATGAGGAAATGAAGGAACACAGG - Intergenic
992255336 5:74915335-74915357 TGAAAGAAATGGAGGGACACAGG + Intergenic
995621674 5:114032406-114032428 TGAAAGATATGGAGTACCACAGG - Intergenic
995876594 5:116796734-116796756 TGGAGGAAATGTAGGAGCGGAGG - Intergenic
997987210 5:138511860-138511882 TGGAGGAAAGGGGGGACCACTGG + Intronic
999041909 5:148423306-148423328 TTGAGGAAATGGAGGTCTAGAGG - Intronic
999376130 5:151087479-151087501 AGGAGGAAATGGAGGTCTTCAGG - Intronic
999688012 5:154119605-154119627 TGGAGGAAAGGGAGAGACACAGG - Intronic
1001436991 5:171706984-171707006 TGGGGGAGATGGATGACCAAAGG + Intergenic
1003133792 6:3417536-3417558 TGGAGCAGTTTGAGGACCACTGG - Intronic
1003347648 6:5285513-5285535 AGGAGGACACGGAGGACCATGGG + Intronic
1005909358 6:30294541-30294563 TGGAGTACATGGGGGACCCCGGG + Intergenic
1006191965 6:32215004-32215026 TGGTGGAAACAGAGGACCAGGGG - Intronic
1006315752 6:33290549-33290571 TGGAGGAACTGGAGGACTAGGGG - Intronic
1007665705 6:43511795-43511817 GGGATGACAGGGAGGACCACTGG + Intronic
1008441743 6:51539676-51539698 TGGACAAATTTGAGGACCACTGG - Intergenic
1009311610 6:62160539-62160561 TGAGTAAAATGGAGGACCACTGG + Intronic
1009817813 6:68758494-68758516 AGGAGGAAATGCAGTACAACTGG - Intronic
1011719790 6:90143622-90143644 TGGAGGATGTGGAGGTGCACAGG - Intronic
1012982980 6:105849677-105849699 TGGAGGCCATGGAGGCCCACAGG - Intergenic
1013308380 6:108871146-108871168 TGGAGGACCTGGAGGTCCAGTGG + Intronic
1014195230 6:118549249-118549271 GAGAGGAAATGGAGTACCACTGG - Intronic
1015499237 6:133914548-133914570 TGGAGAAAATGGATGTTCACAGG + Intergenic
1016367696 6:143337169-143337191 AGGATGAAATGAAGGACCAATGG - Intronic
1018075188 6:160206459-160206481 TGGAAGAAAAGGAGGAGCAAAGG + Intronic
1018132039 6:160740850-160740872 AGGAGGAAATGGAGGATCCAAGG + Intronic
1018745735 6:166760751-166760773 TGGGGGAAATGGAGGCACAAAGG + Intronic
1019008383 6:168822714-168822736 GAGAGGAAATGCAAGACCACAGG - Intergenic
1019539680 7:1546017-1546039 TGGAGGAAGTGGAGGCTCCCAGG + Exonic
1019759402 7:2798921-2798943 TGGAGGAAGTGGACTTCCACAGG + Intronic
1020530847 7:9332932-9332954 TGGAAGAAAAGGAGGAGCTCAGG + Intergenic
1021574491 7:22094785-22094807 TTGTGGAAATGGAACACCACAGG - Intergenic
1022118533 7:27284286-27284308 TGGAGGAAAAGGTGGATCAGAGG - Intergenic
1022522948 7:31019666-31019688 TGTAGGAAGTGGGAGACCACAGG - Intergenic
1023608520 7:41951546-41951568 TGAGGGAAAGGGAGGACCAGTGG - Intergenic
1030315014 7:108105640-108105662 TGGAGGAACTGGAGGGCCCTAGG + Intronic
1030985809 7:116240479-116240501 TGGAGGAAAGGGAGGAGCGAGGG - Intronic
1031204852 7:118743777-118743799 TGGAGAAAATGGAGGATCTTGGG - Intergenic
1032478786 7:132230009-132230031 TGGGATAAATGGAGGAACACAGG + Intronic
1033071794 7:138209652-138209674 TGGAGGACAGGGAGGGCCATGGG + Intergenic
1035779464 8:2216432-2216454 CTGAGGACATGTAGGACCACGGG - Intergenic
1038050733 8:23808204-23808226 AGGAAGAAATGGAGGGCCAGGGG + Intergenic
1038442526 8:27581931-27581953 TGGAGGAAATGGATGTGCAATGG + Intergenic
1038946036 8:32361322-32361344 GGGTAGAAAAGGAGGACCACAGG + Intronic
1039368438 8:36958961-36958983 TGGAGGAATTTGAGGTCCATAGG - Intergenic
1041265169 8:56057637-56057659 TGGTGGATAGGAAGGACCACAGG + Intergenic
1041433866 8:57816916-57816938 TGGTGGGAATAGTGGACCACTGG - Intergenic
1041780036 8:61568048-61568070 GGGAGGAAAGGGAAGACCAATGG + Intronic
1042614647 8:70634963-70634985 TGGAGGAAATTGGGGAACAGGGG - Intronic
1045281002 8:100749703-100749725 TGGAGGAAGAGGAGGAGAACGGG + Intergenic
1046387243 8:113520583-113520605 CTGAGGAAATGGAGAAACACAGG + Intergenic
1047590352 8:126320544-126320566 TGCATCAAATGGAGGACCACAGG - Intergenic
1049353592 8:142177111-142177133 GGGAGAAAATGGAGGCCCAGAGG - Intergenic
1049808990 8:144554883-144554905 GGGAGGAACTGGAGGACCCGAGG - Intronic
1050461991 9:5885052-5885074 TGGAGGAAATGGAGGACCACAGG - Intronic
1052210657 9:25899215-25899237 TGGACAAAATAGAGGACCAAAGG + Intergenic
1052374868 9:27707432-27707454 TGTGGGAAAGGGAGGACCACTGG + Intergenic
1052605139 9:30689443-30689465 AGGAGGAAGTGGAGGAACAAGGG + Intergenic
1053270381 9:36745527-36745549 TTGAGGAACTGGAGCACCTCTGG - Intergenic
1055012878 9:71586369-71586391 TGGACGGAAAGCAGGACCACCGG - Intergenic
1055371471 9:75604282-75604304 TGGAGGAGATGGAGGAACACAGG + Intergenic
1055727990 9:79252118-79252140 TGGAGGAACTGGGGGAACAGAGG - Intergenic
1056568851 9:87798557-87798579 TGGAGGAAACAGAGGAACACTGG + Intergenic
1056685649 9:88757154-88757176 TGGAGCAATTGGATGTCCACAGG - Intergenic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1057782932 9:98064647-98064669 ATGAAGAAATGGAGGACCAGAGG + Intronic
1059153539 9:111970132-111970154 CGTAGGAAATGCAGGCCCACTGG + Intergenic
1059730315 9:117050569-117050591 TGGGGGAAATGGAAGATCAAAGG + Intronic
1060834272 9:126743244-126743266 GGGGGGAATTGGAGGATCACAGG + Intergenic
1061223294 9:129265023-129265045 TGGATGAGATGGAGGAGCAGGGG - Intergenic
1061939546 9:133876654-133876676 TGGAGGGAAGGCAGGACCGCGGG + Intronic
1062105387 9:134752339-134752361 GGGAGGAAACGGGGGCCCACTGG + Intronic
1062733388 9:138121337-138121359 GGGAGGCAATGGGGGACAACGGG - Intronic
1203634047 Un_KI270750v1:95110-95132 ATGAGGAAACGGAGGTCCACAGG - Intergenic
1187766337 X:22646805-22646827 TGGAGGAACTGGAAGAGCAAAGG - Intergenic
1189263235 X:39692983-39693005 TGGAGGAAATGTAGGCACAGTGG - Intergenic
1191045202 X:56129031-56129053 TGGGGTAAATGGAGTGCCACTGG + Intergenic
1192305983 X:69960041-69960063 TGCATGAAATGGAGGACCACTGG + Intronic
1193465962 X:81847887-81847909 TGAAGGACATGGAGGAAAACAGG + Intergenic
1194675228 X:96785981-96786003 TGGAGCAAATGGAAGAGCAGAGG + Intronic
1196314233 X:114203887-114203909 AGGAGGAAAAGGAGGAACAGAGG + Intergenic
1198524940 X:137491617-137491639 TGAAGGCAAAGGAGGAGCACAGG + Intergenic
1198725070 X:139668075-139668097 TGCTAGAAAGGGAGGACCACTGG - Intronic
1198831158 X:140752102-140752124 TTGAGGAAAAGCAGCACCACAGG - Intergenic
1200024902 X:153249720-153249742 TGGAGGAACGGGAGGAACACTGG + Intergenic