ID: 1050462460

View in Genome Browser
Species Human (GRCh38)
Location 9:5888076-5888098
Sequence CCTCAGGTATTATGGGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050462450_1050462460 10 Left 1050462450 9:5888043-5888065 CCAGAAAAATCACAGGATCTGAA 0: 1
1: 0
2: 2
3: 36
4: 345
Right 1050462460 9:5888076-5888098 CCTCAGGTATTATGGGAAAGGGG No data
1050462448_1050462460 29 Left 1050462448 9:5888024-5888046 CCATAGCTCACGATGGAAACCAG 0: 1
1: 0
2: 1
3: 3
4: 60
Right 1050462460 9:5888076-5888098 CCTCAGGTATTATGGGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050462460 Original CRISPR CCTCAGGTATTATGGGAAAG GGG Intronic
No off target data available for this crispr