ID: 1050462460 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:5888076-5888098 |
Sequence | CCTCAGGTATTATGGGAAAG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1050462450_1050462460 | 10 | Left | 1050462450 | 9:5888043-5888065 | CCAGAAAAATCACAGGATCTGAA | 0: 1 1: 0 2: 2 3: 36 4: 345 |
||
Right | 1050462460 | 9:5888076-5888098 | CCTCAGGTATTATGGGAAAGGGG | No data | ||||
1050462448_1050462460 | 29 | Left | 1050462448 | 9:5888024-5888046 | CCATAGCTCACGATGGAAACCAG | 0: 1 1: 0 2: 1 3: 3 4: 60 |
||
Right | 1050462460 | 9:5888076-5888098 | CCTCAGGTATTATGGGAAAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1050462460 | Original CRISPR | CCTCAGGTATTATGGGAAAG GGG | Intronic | ||
No off target data available for this crispr |