ID: 1050466825

View in Genome Browser
Species Human (GRCh38)
Location 9:5935514-5935536
Sequence GTGGACTAGAAATTAACCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050466822_1050466825 3 Left 1050466822 9:5935488-5935510 CCATTTTCATTTACAAAGAATGA 0: 1
1: 0
2: 5
3: 57
4: 594
Right 1050466825 9:5935514-5935536 GTGGACTAGAAATTAACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050466825 Original CRISPR GTGGACTAGAAATTAACCAC TGG Intronic
No off target data available for this crispr