ID: 1050471833

View in Genome Browser
Species Human (GRCh38)
Location 9:6001178-6001200
Sequence AGTAGGAATAGAAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 602
Summary {0: 1, 1: 0, 2: 1, 3: 52, 4: 548}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050471833_1050471837 -4 Left 1050471833 9:6001178-6001200 CCATCCACCTTTCTATTCCTACT 0: 1
1: 0
2: 1
3: 52
4: 548
Right 1050471837 9:6001197-6001219 TACTGTTTATTATCTCTTGATGG No data
1050471833_1050471838 22 Left 1050471833 9:6001178-6001200 CCATCCACCTTTCTATTCCTACT 0: 1
1: 0
2: 1
3: 52
4: 548
Right 1050471838 9:6001223-6001245 TAACTCAATAATCTTTTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050471833 Original CRISPR AGTAGGAATAGAAAGGTGGA TGG (reversed) Intronic
903341795 1:22659333-22659355 TGGAGGAATAGAGAGATGGATGG + Intronic
903474266 1:23608558-23608580 TGAAGGAATTGAGAGGTGGATGG + Intronic
903572736 1:24318486-24318508 AGAAGGGATAGAAAAGTTGAAGG - Intergenic
906055247 1:42910918-42910940 AGAAGGAACATAAAGTTGGATGG - Intergenic
906108872 1:43310263-43310285 AGTGAGAAGAGAAAGGCGGAAGG - Intronic
906464610 1:46065635-46065657 AGTAAGAATAGGAAGGAGAAAGG - Intronic
906735050 1:48117358-48117380 AGGAGGAATAGAAAGGGATAAGG + Intergenic
907116141 1:51970236-51970258 TGTGGGAATAGAAGAGTGGAGGG - Intronic
907512305 1:54970720-54970742 GGTAGGAAGAGAAAGGGGGCTGG + Intergenic
908021869 1:59906306-59906328 AGTAGGAAGCAAAAGGGGGAAGG - Intronic
908342550 1:63196699-63196721 AGTAAGATTAGAAAAGTGGAAGG + Intergenic
909459456 1:75893422-75893444 AGTTGGAATAGGAATGTGTAGGG + Intronic
909536564 1:76742682-76742704 GGAAGAAATAGAAAGTTGGAAGG - Intergenic
910730994 1:90395929-90395951 AGCATGAAAAGAAGGGTGGAAGG - Intergenic
910749684 1:90615419-90615441 AGAAGGAAGAGAAAGTTTGAAGG - Intergenic
911470317 1:98310096-98310118 AGTAGCAATAGAAAAGTGTGTGG - Intergenic
912462918 1:109848763-109848785 AGTATGAATGGATGGGTGGAGGG + Intergenic
912664011 1:111562748-111562770 AAGAGGAACAGAAAGGTGTATGG - Intronic
912873358 1:113330047-113330069 ACTGGGAATAGAAAGGTAGGGGG - Intergenic
913427503 1:118750264-118750286 AGCAGGATTAGAATGGTGAAGGG + Intergenic
913559581 1:120004215-120004237 GGGAGGAATAGACAGGTGAAAGG + Intronic
913607729 1:120481179-120481201 AGTAGGAAAAAAAAGCTGCAGGG + Intergenic
913638279 1:120786326-120786348 GGGAGGAATAGACAGGTGAAAGG - Intergenic
914280169 1:146163636-146163658 GGGAGGAATAGACAGGTGAAAGG + Intronic
914513289 1:148352991-148353013 AGGAAGTATAGAAAGCTGGAGGG + Intergenic
914541214 1:148614575-148614597 GGGAGGAATAGACAGGTGAAAGG + Intronic
914583459 1:149040661-149040683 AGTAGGAAAAAAAAGCTGCAGGG - Intronic
914625426 1:149456670-149456692 GGGAGGAATAGACAGGTGAAAGG - Intergenic
914783465 1:150806873-150806895 ATGAGGAAGAGAAAGGTAGACGG + Intronic
914935311 1:151974109-151974131 AGTAGATATAAAAAGGTTGAAGG + Intergenic
915032634 1:152896729-152896751 AGGAGGTAGACAAAGGTGGAGGG - Intergenic
915121022 1:153629565-153629587 AGTAGGAGAAGAAAGGAGAAAGG - Intronic
915479537 1:156175488-156175510 AGTGGGAAGAGGAAGGAGGAAGG - Intronic
916050491 1:161033087-161033109 AGTATGAAAAGGAAGGTGTAAGG + Intronic
916383398 1:164239115-164239137 GTGAGGAATAGAAAGGTTGATGG - Intergenic
916518372 1:165541280-165541302 AGAAGGAGTAGAAAGGCGGCCGG + Intergenic
917599861 1:176563176-176563198 AGGATGAATAAAAGGGTGGAGGG + Intronic
917785190 1:178447750-178447772 AGTAAGAATAGAGAGGAAGACGG + Intronic
918108829 1:181437997-181438019 AGGAGGAATAGACTGGAGGATGG - Intronic
918204333 1:182295858-182295880 AGGAGGAAGAGAAAGAAGGAAGG - Intergenic
918289652 1:183094358-183094380 AGTGGGAATAGAAAGTTTGTGGG - Intronic
919020594 1:192100207-192100229 GGAAGGAATAGAAAAGTAGAAGG - Intergenic
919519015 1:198564255-198564277 AGAAGGAAAAGAAAGAAGGAAGG - Intergenic
919623656 1:199890200-199890222 AGTAGGAGTTGATAGGTAGAGGG - Intergenic
919878122 1:201885424-201885446 AGGAGGAATAGAAAAAAGGAGGG + Intergenic
920055687 1:203189659-203189681 AGTAGAGACAGAAAGGTGAATGG + Intergenic
920081939 1:203381302-203381324 AATAGGAAATGAAAGTTGGAGGG + Intergenic
920148173 1:203880892-203880914 AGTAGGAATGGAATGGGTGACGG + Intergenic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921479749 1:215650485-215650507 AGAAGGATAAGAAAGATGGAGGG + Intronic
922128691 1:222755384-222755406 AGGAGGAAGAGAGAGGGGGAAGG + Intergenic
922445240 1:225691441-225691463 AGAAGGAAAAGAAATGTGAAAGG - Intergenic
922931785 1:229395862-229395884 AGTAGCAATAGAGAGTGGGAAGG - Intergenic
923340174 1:233000230-233000252 AGAAGAAATAGAATGGTGGTGGG - Intronic
923845005 1:237719989-237720011 AGTTGGAATAAAAACATGGATGG + Intronic
1062871845 10:911566-911588 AGAAGGAGTAGAAGTGTGGAAGG - Intronic
1063039766 10:2325225-2325247 AGCAGGCAGAGGAAGGTGGACGG + Intergenic
1063108297 10:3012928-3012950 AGTAGGAACATAAGGTTGGAAGG - Intergenic
1063222919 10:3987590-3987612 AGTAGGACCTGAAACGTGGAGGG - Intergenic
1063249218 10:4255449-4255471 AGTAGCAAAAGAGAAGTGGAAGG - Intergenic
1063296362 10:4810791-4810813 AGAAGGCATAGGAAGTTGGAAGG + Intronic
1063490616 10:6460453-6460475 AGTAGGAATAAAAATTAGGAGGG - Intronic
1063529703 10:6819402-6819424 AGGAGGAACAGAAAGTTGGGAGG - Intergenic
1063900411 10:10726982-10727004 AGGAGGAAGAGAGAGGGGGATGG + Intergenic
1066438970 10:35419409-35419431 GGTAGAAAGAGAAAGGTGGTAGG + Intronic
1066463437 10:35632891-35632913 AGTAGCCAGAGAAAGGTGGAAGG - Intergenic
1066556194 10:36616642-36616664 AGGAGGAAAAAAACGGTGGAAGG - Intergenic
1066646861 10:37619149-37619171 AGTAGGAATAACAAGCTGAAGGG + Intergenic
1067180227 10:43979750-43979772 AGTTGGGAGAGAGAGGTGGAAGG + Intergenic
1067251522 10:44590670-44590692 AGTCGGAAAGGGAAGGTGGAAGG - Intergenic
1067798800 10:49342220-49342242 AGGAGCAATAGAAAGGTTGGGGG + Intergenic
1068730493 10:60352755-60352777 AGTAGAAATAGAAAAGTAAATGG - Intronic
1068873860 10:61976045-61976067 ACTAGGAATACAGTGGTGGAAGG + Intronic
1069180339 10:65351096-65351118 ATTAGGAACTCAAAGGTGGAAGG + Intergenic
1070018344 10:72557813-72557835 AGAATGAATAGAAAAATGGAAGG - Intronic
1070376320 10:75834532-75834554 AGAAGGAAAAGATAAGTGGAGGG - Intronic
1070707187 10:78648241-78648263 GTTAGGAACAGGAAGGTGGAAGG - Intergenic
1071518698 10:86315747-86315769 AGTGGGAGTAGATAGATGGATGG - Intronic
1072236196 10:93455726-93455748 AGTTGGGAGAGAAAGGTGGGTGG + Intronic
1074091903 10:110268172-110268194 AGAAGGAAGAGACAGGTGGAGGG - Intronic
1074126253 10:110530751-110530773 ATTAGAAATTGAAAGGTGCAAGG + Intergenic
1074197562 10:111202926-111202948 TGGAGGAAAAGAAAGGAGGAAGG - Intergenic
1075304222 10:121353571-121353593 TGGATGAATAGACAGGTGGATGG + Intergenic
1075343173 10:121663265-121663287 AGAAGGAAGAGAATGGTGGCGGG - Intergenic
1075412155 10:122236300-122236322 AGAAGAAATTGAATGGTGGAAGG - Intronic
1075785638 10:125048310-125048332 AGTTGGGATAGAAATGAGGATGG - Intronic
1076171277 10:128322243-128322265 CGTGGGAACAGGAAGGTGGAAGG + Intergenic
1076190177 10:128477360-128477382 GGGAGGAAAAGAAAGGTGGTAGG + Intergenic
1076528539 10:131128215-131128237 AGAAGGAATAGAAAGTGGGAAGG + Intronic
1077288080 11:1776338-1776360 AGAGGGAATGGAGAGGTGGATGG + Intergenic
1077288086 11:1776361-1776383 AGAGGGAATGGAGAGGTGGATGG + Intergenic
1077288092 11:1776384-1776406 AGAGGGAATGGAGAGGTGGATGG + Intergenic
1077288098 11:1776407-1776429 AGAGGGAATGGAGAGGTGGATGG + Intergenic
1077480873 11:2813957-2813979 AGGATGAATAGAGAGATGGAGGG + Intronic
1077885558 11:6385054-6385076 AGTAGGAAAAGGAGGGAGGAGGG - Intergenic
1078167047 11:8896365-8896387 AGGAGGAATATAAAATTGGAAGG + Intronic
1078406247 11:11072323-11072345 AGTGGGAATAGCAAGGTTAAAGG - Intergenic
1078659114 11:13271463-13271485 AGAAGGAAAAGAAAGAAGGAAGG - Intergenic
1078914766 11:15769166-15769188 AATAGGAAATGCAAGGTGGATGG - Intergenic
1078934386 11:15938869-15938891 AGTAGCAATAGCTAGTTGGATGG - Intergenic
1079327587 11:19507471-19507493 ATTTGGTATAGAAATGTGGAGGG + Intronic
1081734806 11:45395222-45395244 AGGAAGAGGAGAAAGGTGGAAGG - Intergenic
1081768264 11:45628039-45628061 AGTAGGAAAACAAAGGGGCAGGG + Intergenic
1082059254 11:47846605-47846627 ACTAGAAATAGAAAAGTAGATGG - Intronic
1082810979 11:57478865-57478887 GGTGGGAATAGAAAGATAGAGGG + Intergenic
1084909762 11:72378995-72379017 AGCAGGTTTAGAGAGGTGGAAGG + Intronic
1085214361 11:74815174-74815196 ATTGGGAATAGAAATGTAGAGGG + Intronic
1085313473 11:75529707-75529729 AGTGGGAATGGGCAGGTGGAGGG + Intergenic
1085418609 11:76336748-76336770 AGGAGGAAGTGATAGGTGGATGG + Intergenic
1085713352 11:78850677-78850699 GGCAGCAAGAGAAAGGTGGAAGG + Intronic
1085746827 11:79122243-79122265 AGGAGGGAAAGAAAGGAGGAAGG + Intronic
1086365028 11:86100448-86100470 AGGAAGAATAGAAGGGAGGAAGG - Intergenic
1087168699 11:95028642-95028664 AGGAGGAAGAGAGAGGGGGACGG - Intergenic
1087204243 11:95377398-95377420 AGAAGGAGTAGAAAGGGGCAGGG - Intergenic
1087326674 11:96732335-96732357 ACAAAGAATAGAAAGGTGGGAGG - Intergenic
1087601981 11:100328558-100328580 AGAAGGAAGAGACAGGTGGGAGG + Intronic
1088212637 11:107473540-107473562 AGTAGGTAGAAGAAGGTGGAAGG - Intergenic
1088329835 11:108639865-108639887 AGAAGGAAGAGAAAGGTGGGTGG + Intergenic
1089076899 11:115745580-115745602 AGGAGAAAGAGAAAGATGGAGGG + Intergenic
1089626051 11:119751717-119751739 GCTAGGAAGAGAAATGTGGAGGG - Intergenic
1089700463 11:120241060-120241082 AGGAGGAACAGCAAGGTGAATGG - Intronic
1089870974 11:121672543-121672565 AGTAGGAATAGAAAGGGCCTTGG - Intergenic
1089936298 11:122367639-122367661 AGAAAGAAAAGAAAGATGGAAGG + Intergenic
1090030180 11:123199538-123199560 AGAAAGAATAGAAAGATGGATGG - Intergenic
1090718378 11:129451068-129451090 ACTGGGAGTGGAAAGGTGGAGGG + Intronic
1092458480 12:8665955-8665977 GGAAGGAAAAGAAAGGGGGAAGG + Intergenic
1093145984 12:15567429-15567451 AGAAGAAAAAGAAAGCTGGAAGG - Intronic
1093366801 12:18312031-18312053 AGCAGGCAGAGAAACGTGGAAGG - Intronic
1093478245 12:19578603-19578625 AGTAGGAATAGAAAGCAGGTAGG + Intronic
1093499121 12:19790761-19790783 AGAAGGACAAAAAAGGTGGAAGG + Intergenic
1093523856 12:20083831-20083853 AATAAGAATAGAAAGCTGGTAGG - Intergenic
1094016938 12:25874820-25874842 AGTAGGAAGAGAGAGAAGGAAGG + Intergenic
1095912410 12:47442053-47442075 AGAAGAAATGAAAAGGTGGAAGG - Intergenic
1096152840 12:49325463-49325485 AGAAGGAAAAGGAAGGGGGAAGG - Intronic
1096950917 12:55470164-55470186 TCTAGGAATAAAAAGGTGCAAGG + Intergenic
1097614062 12:61862674-61862696 ATTAGAAATAGCAAGGAGGATGG - Intronic
1098425187 12:70355930-70355952 AGTAGGAAGAAAAATGTGGAAGG + Intergenic
1098806770 12:75030424-75030446 AGTAAGATTATAAAGGTAGATGG + Intergenic
1098833640 12:75393429-75393451 AATAGGAATAGAAAGTAGAATGG - Intronic
1099018239 12:77371298-77371320 AGCAGGAATATAAAGGAGGTGGG + Intergenic
1099313145 12:81052887-81052909 AGAAGGAAAAGAAAGGAAGAAGG + Intronic
1099313158 12:81052938-81052960 AGAAGGAAAGGAAAGGAGGAAGG + Intronic
1100133450 12:91524268-91524290 AGTGGAGACAGAAAGGTGGATGG + Intergenic
1100705008 12:97191090-97191112 AGCAAGAGAAGAAAGGTGGATGG + Intergenic
1101571452 12:105957617-105957639 AGGAGGAAATGAGAGGTGGAAGG - Intergenic
1102311095 12:111844876-111844898 TGTAGGAAGAGCAAGGTGGCTGG + Intronic
1102764746 12:115423007-115423029 AGGAGGAATGGAAGGGAGGAAGG + Intergenic
1102843827 12:116155915-116155937 ATTAGAAATAGTAAGGTGGAGGG + Intronic
1102866986 12:116382313-116382335 AGAAGGAAGAGGAAGGAGGAGGG + Intergenic
1103022984 12:117551289-117551311 AGGAGGAATAGGAAGAAGGAAGG - Intronic
1103280308 12:119752765-119752787 AGATTGAATAGATAGGTGGATGG - Intronic
1103735942 12:123060932-123060954 AGTAGGGATGCATAGGTGGAAGG - Intronic
1103894637 12:124264892-124264914 AGCAAGAATAAAAAGGAGGAAGG - Intronic
1104083573 12:125455177-125455199 TGGAGGAAATGAAAGGTGGAAGG + Intronic
1104508852 12:129357465-129357487 AGTAGAAAAAGGAAGGAGGAAGG + Intronic
1107897123 13:44976316-44976338 AGGAGGAGAAGAAAGGAGGAAGG + Intronic
1107982716 13:45748811-45748833 TGTAGGCAAAGAAAGCTGGATGG + Intergenic
1111048105 13:82842659-82842681 AGGAGGAATAGAAAGCTGTAGGG + Intergenic
1111510311 13:89253040-89253062 AGGATGAATAAAGAGGTGGATGG + Intergenic
1111547560 13:89762334-89762356 AGAAGGAATAGGAGAGTGGAGGG - Intergenic
1111585794 13:90282717-90282739 AGGAGGAATGGAGAGGTGCACGG + Intergenic
1111632456 13:90859727-90859749 ACTAAGAATAGAAAGGGGAAGGG - Intergenic
1111692411 13:91580707-91580729 GCAAGGAATAGGAAGGTGGATGG - Intronic
1113433940 13:110274508-110274530 AGGAGGAATTGAGAGGTGTAGGG - Intronic
1113598353 13:111550122-111550144 TGGATGAATAGAAAGATGGATGG - Intergenic
1114346430 14:21800166-21800188 AATGGGAATAAAAAGGTCGAAGG + Intergenic
1114479392 14:23022889-23022911 AGTAGAAAAAAAAAGGTGGATGG - Intronic
1115292215 14:31785073-31785095 AGAAAGAATTGAATGGTGGAAGG - Intronic
1115520196 14:34225773-34225795 AGAATGGATAGAAAGATGGATGG + Intronic
1116106963 14:40521106-40521128 AAAAGGAATAAAAATGTGGATGG - Intergenic
1116823984 14:49653207-49653229 AGTGGAAATATAAATGTGGAAGG + Intronic
1117106712 14:52404842-52404864 AGAATGAATAGATAGGTGAAAGG - Intergenic
1117571339 14:57052083-57052105 AGTAGGAAAAGAAAGGATGAAGG - Intergenic
1117791385 14:59345535-59345557 AGTTTAAATAGCAAGGTGGATGG + Intronic
1117793867 14:59370912-59370934 TTAAGGAATAGACAGGTGGAGGG + Exonic
1118389365 14:65283283-65283305 AGTGGGCACAGAAAGATGGAAGG - Intergenic
1119500265 14:75120724-75120746 AGTAGGCAAAGAAAAGTGAAGGG + Intronic
1119862898 14:77949338-77949360 AGAAGTAATAGAAGGGTGAATGG - Intergenic
1120505224 14:85347479-85347501 AGCAGCAATAGCAAGGGGGAAGG + Intergenic
1120864012 14:89280126-89280148 AGGAGGGATAGAAAGCTCGAAGG + Intronic
1121005009 14:90484511-90484533 GGTAGGAATGGGAAGGTGGATGG - Intergenic
1121961852 14:98267411-98267433 TGTATGGATAGAAAGATGGATGG + Intergenic
1122355048 14:101117923-101117945 TGGACGAATAGAAAAGTGGATGG - Intergenic
1123795870 15:23769395-23769417 AGCAGGAAGAGGAACGTGGAAGG - Intergenic
1125079828 15:35659714-35659736 AGTAGCAATGGAAAGCAGGATGG + Intergenic
1126111875 15:45179959-45179981 AGAGGGAATAGCAAGGTGGAAGG - Intronic
1126292348 15:47096295-47096317 CTGTGGAATAGAAAGGTGGAAGG + Intergenic
1126356689 15:47803534-47803556 ATTTGGAATAGAAGGGAGGAAGG + Intergenic
1126405105 15:48315374-48315396 AGAACGAATAGAAGGGTGGTTGG + Intergenic
1126506083 15:49406243-49406265 AGCAGCAATAGAAATGTGGTGGG + Intronic
1126573837 15:50179055-50179077 AGTAGAAAGAGGAAGGTGCAGGG + Intronic
1126787300 15:52187498-52187520 AGGAGGAATAGAAGGATGGCTGG + Intronic
1126892944 15:53225554-53225576 ATTTGGAATATAAAGGTGGAAGG - Intergenic
1128702120 15:69812508-69812530 ATGAGGGACAGAAAGGTGGATGG + Intergenic
1128918544 15:71590035-71590057 AGTAGGAATATAAATATGCATGG + Intronic
1128992308 15:72271460-72271482 AGTTGGAAAAGGAAGGTGGTGGG + Intronic
1129509853 15:76113408-76113430 ACTAGGAACAGATAGGTGGCTGG + Intronic
1129832963 15:78682517-78682539 AGAAGGAAGAGAAAGGGAGAAGG + Intronic
1131289053 15:91089211-91089233 AGTGGGAATGGAAATGAGGAGGG + Intergenic
1131315841 15:91336534-91336556 AGAAGGAAGAGAGGGGTGGACGG - Intergenic
1131701280 15:94938757-94938779 AGCAGGCAGAGGAAGGTGGAAGG - Intergenic
1131730587 15:95275819-95275841 AGTAGGAATAAAGAGGTAGCTGG - Intergenic
1133645863 16:7763992-7764014 GGAAGGAAAAGAAAGGGGGAAGG - Intergenic
1133721108 16:8495226-8495248 AATAGGAATAGAAAAGTGAGTGG - Intergenic
1135079645 16:19423095-19423117 AGAAGGAAGAGAAAGGAGAAGGG - Intronic
1135394655 16:22122106-22122128 AGAAGGAAAAGAATGATGGATGG + Intronic
1135546095 16:23367768-23367790 AGGAGGAAATGAAAGGTGGACGG + Intronic
1135734731 16:24921603-24921625 TGTAGGGACAGGAAGGTGGAAGG - Intronic
1137037158 16:35576900-35576922 AATAGCAATAGAAAGGAGGCAGG - Intergenic
1137836462 16:51597175-51597197 AGGAGCAAGAGAAAGGGGGAAGG - Intergenic
1137995742 16:53209714-53209736 AAGAGGAAAAGAAAGGTAGAAGG + Exonic
1138065443 16:53936458-53936480 ATGAGGAAAAGAAAGGTGTATGG - Intronic
1138226877 16:55303511-55303533 GGGAGGAATAGACAGGTGGAAGG + Intergenic
1138288867 16:55830716-55830738 AGAAGGAAAGGAAAGATGGAAGG + Intronic
1139946301 16:70644798-70644820 AGGAGGAATGAAAAGGAGGAAGG + Intronic
1140770593 16:78200366-78200388 AATAGGAAAAGAAAGGAGGAAGG + Intronic
1141412289 16:83843792-83843814 AGAAGGAAAGGAAAGGAGGAAGG + Intergenic
1142137526 16:88458474-88458496 AGTTGGAGAAGAAAGGAGGAGGG + Intronic
1143704353 17:8686943-8686965 GGTAGGAAGAGAAGGGTGGACGG - Intergenic
1144405809 17:14951706-14951728 ATTAGGAACAAAAAGGAGGAGGG - Intergenic
1145872533 17:28286943-28286965 AATAGGAATAGGTAGGTGGTAGG - Intergenic
1146031866 17:29373105-29373127 AGTAGGAATAAAAAGGAGCATGG - Intergenic
1146822683 17:35997219-35997241 AGTTGGAATAGGAAGTTAGAAGG + Intronic
1148988800 17:51647440-51647462 AGAAGGAAAAGACAGATGGAAGG - Intronic
1149311140 17:55395353-55395375 ACTAGGAATAGAAAGGAGACAGG + Intronic
1149339289 17:55669415-55669437 AGAAAGAAAAGAAAGGAGGAGGG - Intergenic
1149633441 17:58145643-58145665 AGTAACAACATAAAGGTGGAGGG + Intergenic
1149775097 17:59351071-59351093 AGGAGTATTAGAAAGGTGGAAGG + Intronic
1151419334 17:73987050-73987072 AGGAGCAATGGAAAGTTGGAAGG + Intergenic
1151522199 17:74638289-74638311 AGGAGGAAGAGAAAGCAGGAGGG - Intergenic
1151634103 17:75332238-75332260 AGTAGGAACACTAAGATGGAGGG + Intronic
1152006580 17:77685968-77685990 AGGAGGAATAGAGGGATGGATGG - Intergenic
1152919824 17:83060652-83060674 AGGAGGAAAAGAGAGGGGGAAGG - Intergenic
1154364090 18:13690233-13690255 AGTAGGAAAAGAAAGCAGCAGGG + Intronic
1155195769 18:23472506-23472528 AGTGGGAATGAAAAAGTGGATGG - Intronic
1156438808 18:37163359-37163381 AGGAGGAACAAAAAGGAGGAAGG - Intronic
1157482447 18:48064205-48064227 GGTTGGAATGGCAAGGTGGATGG - Intronic
1157520124 18:48339662-48339684 AGTGGGAATGGGAAGGAGGAGGG + Intronic
1158414172 18:57234660-57234682 ATGAGGAAAAGAAAGGTGGGAGG + Intergenic
1159361401 18:67408704-67408726 AGTAGGTATATAAAGGTATATGG + Intergenic
1159516586 18:69466765-69466787 AGTAGGAAAAGTAAGAGGGAGGG + Intronic
1162034391 19:7931466-7931488 TGGAGGAAGAGAAAGGTGGCTGG + Intronic
1162142100 19:8591283-8591305 AGGAGGAAAAGAGAGCTGGAAGG + Intronic
1162245082 19:9393308-9393330 AAAAGGAAGAGAAAGGGGGAAGG - Intergenic
1164146026 19:22513079-22513101 TGTGGGTAGAGAAAGGTGGAAGG - Intronic
1164916721 19:32058075-32058097 AGGAGGGAAAGAAAGGGGGAAGG - Intergenic
1164916752 19:32058217-32058239 GGAAGGAAGAGAAGGGTGGAAGG - Intergenic
1164916785 19:32058375-32058397 GGAAGGAAGAGAAGGGTGGAAGG - Intergenic
1165790184 19:38486642-38486664 AGGATACATAGAAAGGTGGATGG - Intronic
1165994969 19:39837571-39837593 TGCAGGAATAGAAAGGGGTAAGG - Intronic
1166160226 19:40947218-40947240 AGGAGGAAAAGGAAGGCGGAGGG + Intergenic
1166169116 19:41014854-41014876 AGTAGGAAAAGGAAGGAGGAGGG + Intronic
1167022194 19:46885740-46885762 ACTAAAAATAAAAAGGTGGAGGG - Intergenic
1167235411 19:48311666-48311688 CCTGGGAGTAGAAAGGTGGATGG + Exonic
925149764 2:1607037-1607059 GGAAGGAGCAGAAAGGTGGAGGG - Intergenic
926264627 2:11304268-11304290 AGTAGGAAAAGGAAGGGGTAGGG - Intronic
926266844 2:11330896-11330918 AGGAGGAAGAGAGAGGAGGAGGG + Intronic
926806089 2:16712663-16712685 TGTGGTAATAGAAAGGTAGAAGG - Intergenic
927037151 2:19189764-19189786 ATTGGGAATGGGAAGGTGGAAGG + Intergenic
927347684 2:22065579-22065601 AGCAGGAAGAGAAAAGGGGAAGG - Intergenic
927860002 2:26554793-26554815 AGTAAGAATGAAAAGGTGGAGGG + Intronic
928682247 2:33714466-33714488 GGAAGGAAAAGAAAGGAGGAAGG + Intergenic
928921839 2:36534715-36534737 AGAAGGAAAAGGAAGATGGAAGG + Intronic
929925238 2:46202035-46202057 AGTCGGAATTGGAGGGTGGAGGG + Intergenic
930236550 2:48894416-48894438 TGGATGAATAGAAAGATGGATGG - Intergenic
930267715 2:49219314-49219336 AGAATGAATGGATAGGTGGATGG - Intergenic
931921735 2:67024271-67024293 AAGAGGAAAAGAAAGATGGATGG - Intergenic
932139887 2:69266017-69266039 AGCAAGATTAGAAAGGGGGATGG + Intergenic
933685820 2:85140464-85140486 TGGAGGAAAAGAAAGGGGGAGGG - Intronic
935431403 2:102979991-102980013 AGTAGGAGTGGAGAGGGGGATGG - Intergenic
936061949 2:109300646-109300668 AGAAGGAAGAGGAAGATGGATGG - Intronic
936061954 2:109300673-109300695 AGGAGGAAGAGGAAGGTGGTTGG - Intronic
936804761 2:116317110-116317132 AATAGGATTAGAAAGGTGTTTGG + Intergenic
936946929 2:117939575-117939597 AGCAGGAATAGAAAAGTAAAGGG + Intronic
937146099 2:119646180-119646202 AGAAGGAGTATAAAGGTGGAGGG + Intronic
937390867 2:121485201-121485223 AGGAGGCAGAGAAAGGTAGAAGG + Intronic
937871448 2:126789173-126789195 ACCAGGGATAGAAAGGAGGAGGG - Intergenic
938875357 2:135526710-135526732 GGTAGGAAAACAAAGGGGGAAGG - Intronic
938994798 2:136666919-136666941 AGTAAGAATAGAAGAGAGGATGG - Intergenic
939091323 2:137782995-137783017 AGAAGGCATAGAATGGGGGATGG + Intergenic
939481658 2:142755633-142755655 AGTAGTAATAGCAGGGTGGGTGG - Intergenic
939482089 2:142761904-142761926 AGTAGTAATAGCAGGGTGGGTGG - Intergenic
940209934 2:151245877-151245899 AGAAGGAAAACAAAGGGGGAAGG + Intergenic
940473639 2:154132014-154132036 AGCAGGCAGAGAAATGTGGAAGG - Intronic
941361593 2:164558137-164558159 AGTAGGAGGATAAAGGTGAATGG - Intronic
941468686 2:165859071-165859093 AGAAGGAATATAAAGGTCAAGGG + Intronic
942430839 2:175909734-175909756 AATAAGAAAAAAAAGGTGGAGGG + Intergenic
943401816 2:187421878-187421900 AGAGGGAAAAGAAAGTTGGATGG - Intronic
943538544 2:189182939-189182961 AGCAGAAGAAGAAAGGTGGAAGG - Intergenic
944038871 2:195331827-195331849 TGTAGGAATAGAACTGTAGATGG - Intergenic
945042780 2:205755885-205755907 AGGGTGAAGAGAAAGGTGGATGG + Intronic
945044867 2:205773011-205773033 TGGATGAATAGATAGGTGGATGG - Intronic
946456714 2:219832436-219832458 AGCAGGAAGGGAAAGGTGAAAGG - Intergenic
946634387 2:221708110-221708132 ACTGGGAATAGGAAAGTGGAGGG - Intergenic
946941854 2:224777422-224777444 AGTAGGCAGAGGAATGTGGAAGG + Intronic
947909203 2:233790540-233790562 AGGAGAAAAAGAAAGGGGGAGGG - Intronic
948091818 2:235301830-235301852 AGGATGAAGAGAAAGGAGGAGGG - Intergenic
948436497 2:237957101-237957123 AGTCGGAATGGAGAAGTGGAAGG - Intergenic
948536372 2:238650499-238650521 AGCAGGAGCAGAAGGGTGGATGG - Intergenic
1168899315 20:1348099-1348121 AGTAGGGAGGGAAATGTGGATGG - Intronic
1169490443 20:6067105-6067127 AGGAAGAATAGGAAGGTGAAGGG + Intergenic
1169868809 20:10229953-10229975 AGTAGAACTAGAAAGGAGTAAGG - Intronic
1169944206 20:10971616-10971638 AGAAGGAAAAGCAATGTGGAAGG - Intergenic
1170032272 20:11955891-11955913 AGTGGGAAGAGAAAAGAGGATGG + Intergenic
1170353574 20:15468755-15468777 AGGAGGAAGAGAAAGGAAGATGG - Intronic
1170377370 20:15714777-15714799 AGTAGGAATAAAAAAGTATATGG - Intronic
1170421363 20:16196683-16196705 AGCAGGAATAGAAGGGGGAAAGG + Intergenic
1170611040 20:17913641-17913663 AGTAAGAGTAGAAGAGTGGAGGG + Intergenic
1171297641 20:24032766-24032788 AGGAAGAAAGGAAAGGTGGAAGG - Intergenic
1171568755 20:26224252-26224274 AGTAGGAATAGAAACGCAGAAGG - Intergenic
1172065716 20:32218814-32218836 AGTAGGAAGAGAAAGGACAATGG + Intronic
1172216705 20:33240613-33240635 AGGATGAATAGATAGATGGATGG + Intronic
1172230779 20:33334194-33334216 TGTAAGGATAGATAGGTGGATGG + Intergenic
1173892072 20:46520509-46520531 AGTAAGAAGAGAAAGTAGGATGG - Intergenic
1174124410 20:48292480-48292502 AATATGAATAGAAGGATGGAGGG + Intergenic
1174379788 20:50149260-50149282 AGGGGGAAGGGAAAGGTGGAGGG - Intronic
1174409244 20:50322827-50322849 AGGAGGAATAGAAGAATGGATGG - Intergenic
1174539082 20:51275172-51275194 AGAAGAAAAAGAAAGGAGGAAGG - Intergenic
1175765868 20:61592626-61592648 TGTAGGAAAAGCAGGGTGGAGGG - Intronic
1176273919 20:64252847-64252869 AGTAAGCACAGGAAGGTGGATGG - Intergenic
1177065475 21:16428407-16428429 TGAAGGAATAGAAAACTGGAAGG - Intergenic
1177177123 21:17712278-17712300 GGAAGGAAGATAAAGGTGGAGGG - Intergenic
1178282713 21:31297284-31297306 GGCAGAAATAGAAAGGTGGATGG + Intronic
1178614752 21:34122358-34122380 AGTATAAAACGAAAGGTGGAAGG - Intronic
1178964559 21:37104069-37104091 AGTGGGAATGGAAAAGTAGAAGG + Intronic
1179399506 21:41070790-41070812 AGGAGGAAAAGAAGGATGGAGGG + Intergenic
1180282172 22:10711397-10711419 AGTAGAAATAGAATGGCAGAAGG + Intergenic
1180413272 22:12636385-12636407 AGGAGGAAGAGAGAGGGGGAAGG + Intergenic
1181497916 22:23298392-23298414 AGCTGGAATAAAAAGCTGGAGGG + Intronic
1181536891 22:23550986-23551008 AAGATGGATAGAAAGGTGGATGG - Intergenic
1181536897 22:23551021-23551043 AGTATGGATGGAAAGATGGATGG - Intergenic
1184672552 22:46023027-46023049 AGGAGGAGAAGAAAGGAGGAAGG + Intergenic
949676785 3:6463551-6463573 AGAGGGGGTAGAAAGGTGGAGGG + Intergenic
949949935 3:9220893-9220915 AGCAGGACTAGCAATGTGGATGG - Intronic
950305729 3:11914411-11914433 AGTAGCACTGGAAAGGTGGCAGG + Intergenic
950471129 3:13187047-13187069 AAGAGGGATAGAAAGGAGGAAGG - Intergenic
950629889 3:14275447-14275469 AGTGGGATTAGACAAGTGGAGGG - Intergenic
950845547 3:16012087-16012109 AGAAGGAAAAGAAAGAGGGAGGG + Intergenic
951302099 3:21010345-21010367 AGCAGGCAGAGAAATGTGGAAGG + Intergenic
951353058 3:21630184-21630206 AGAAAGAAAAGAAAGGTGGTAGG - Intronic
951549363 3:23861640-23861662 CGAAGGAATACACAGGTGGATGG + Intronic
952171142 3:30808123-30808145 AGAAGGAAGAAAAAGGAGGAGGG + Intronic
952241201 3:31532886-31532908 AGGAGGAAGAAAAAGGAGGAGGG - Exonic
952370780 3:32720868-32720890 AGAAGGAAAAGAAAGAAGGAAGG - Intronic
952640772 3:35592824-35592846 AGTAGGAAAAGAAAGGGATATGG - Intergenic
953097948 3:39797416-39797438 AATAAAAATAGAAATGTGGAGGG - Intergenic
953117972 3:40011360-40011382 AGAAGGAATAGAAAGAGGGAAGG - Intronic
953383569 3:42492221-42492243 AGGAGGAAGAGAAAAGAGGAAGG - Intronic
953485852 3:43294795-43294817 AGGAGGAATAAAAAGATGGTAGG + Intronic
953800331 3:46018018-46018040 AGTATGAATAGGAAGATAGAAGG - Exonic
954819893 3:53316855-53316877 AGTAGAAATGGAAAGCTGGAAGG - Intronic
956723358 3:72137361-72137383 AGAAGGAAGAGAGAGGGGGAGGG + Intergenic
956861457 3:73327923-73327945 TGTAGAAATAGAGAGGAGGAGGG - Intergenic
957080330 3:75631337-75631359 AGTAGAAATAGGGAGCTGGATGG - Intergenic
957110093 3:75944102-75944124 AGTAGGAATAGAATGGCAGAAGG + Intronic
957550947 3:81703733-81703755 ATTTGGAAAAGAAAAGTGGATGG + Intronic
957855097 3:85864885-85864907 AGTTGGAATAAAAAGGAGAAAGG - Intronic
960163981 3:114380981-114381003 AGTAGAAATTTAAAGTTGGAAGG - Intronic
960176229 3:114520824-114520846 AGGAGGAAGAGAAAGTTTGAAGG - Intronic
960439067 3:117664525-117664547 AGGATGAATAGACAGGTGGATGG - Intergenic
961026758 3:123565070-123565092 AGTGGGAGTAGAGAGGTGAATGG - Intronic
961560817 3:127728385-127728407 AATAAGAATAGATGGGTGGATGG - Intronic
962076804 3:132090717-132090739 AGGAGGAAGAGAGAGGAGGAAGG + Intronic
962522790 3:136212604-136212626 GGTAGGAAGAGAAAGGAGGTGGG + Intergenic
962865938 3:139448083-139448105 AGGAAGAAGAGAAAGGAGGAAGG - Intergenic
963562724 3:146886393-146886415 AAGAGGAATAGAAAGGGGGAGGG + Intergenic
963641504 3:147865969-147865991 TGTTGGCATGGAAAGGTGGAAGG + Intergenic
963711852 3:148755436-148755458 AGGAGGAATAGAAAGGAGGAGGG - Intergenic
964219566 3:154327878-154327900 AGAAGAAATGGAAAGGGGGAAGG - Intergenic
964328236 3:155571693-155571715 ATTAGGAATAGAAAGATGGCCGG - Intronic
965249388 3:166323233-166323255 AGCAGGAATAGAACAGGGGAAGG + Intergenic
965542943 3:169888766-169888788 CTTAGGAATACAAAGGAGGATGG - Intergenic
966107224 3:176350783-176350805 AGTAGGCAGAGGAATGTGGAAGG - Intergenic
966319895 3:178690533-178690555 AGAAGGAAGAGAAAGAGGGAGGG + Intronic
967357731 3:188591563-188591585 ACTAGGAATAGAGAGTTTGAAGG - Intronic
967366412 3:188691473-188691495 TGTAATAATAAAAAGGTGGATGG + Intronic
969424906 4:7118473-7118495 TGGAGGAATGGAAAGATGGATGG + Intergenic
969451050 4:7273591-7273613 AGTAGGGGTGCAAAGGTGGAAGG - Intronic
970136254 4:12927769-12927791 AGAGGGATTAGAAAGGTGAAGGG + Intergenic
970166436 4:13243121-13243143 ATTAGGAATAGAAAGATTAATGG - Intergenic
970547570 4:17145394-17145416 AGCAGGCAGAGAAACGTGGAAGG + Intergenic
971178673 4:24306794-24306816 AGTAGTAATAGGAAGGAGGAAGG + Intergenic
971394290 4:26214343-26214365 AAAAGGAAGAGAAAGGAGGAAGG + Intronic
972123938 4:35740428-35740450 AGTAGGCAGAGGAATGTGGAAGG + Intergenic
972672136 4:41222931-41222953 AATAGGAAAAGAAAGGAAGATGG + Intergenic
973268894 4:48240330-48240352 AGCAGGAAGAGAAAGGAGGGAGG + Intronic
974818327 4:67034731-67034753 AGCAGGCAGAGAAATGTGGAAGG - Intergenic
975570468 4:75812138-75812160 TCTAGGAAAAGAAAGGTGAAAGG - Exonic
975915191 4:79316862-79316884 AGTAGGAACAGAAAAGTAGAAGG + Exonic
975968587 4:80006142-80006164 AGTAGAAACATAAAGGAGGAAGG - Intronic
976218658 4:82738579-82738601 AGTAGGTATGGAAGGGTGGAAGG - Intronic
976245502 4:83002414-83002436 AGGAGGGATAGAAAGGAGGGAGG + Intronic
976310419 4:83606277-83606299 AGTGAGAACAGAGAGGTGGATGG - Intergenic
977836347 4:101649665-101649687 TGTGGGAAGAGAAAGGTGGGTGG + Intronic
978315383 4:107429920-107429942 AGCAGGAATAGCAAAGTTGATGG + Intergenic
978622816 4:110651357-110651379 ACTAGGAATACAGAGATGGAAGG + Intergenic
978657722 4:111085260-111085282 AGTAGGAAAAGAAAGAGGAAGGG - Intergenic
978894969 4:113875629-113875651 AGAAGGTATAGAATGGGGGATGG + Intergenic
979160547 4:117455038-117455060 AGTAGGAAAACAGAAGTGGAGGG - Intergenic
979675759 4:123408884-123408906 AGTAGGAAGGGAAAGGGGGCGGG + Intergenic
979877877 4:125916489-125916511 GGAAGGAAGAGAAAGGGGGAGGG - Intergenic
980968753 4:139549587-139549609 AGGAGGAAGAGAAAGAGGGAAGG - Intronic
981515065 4:145598849-145598871 AGGTGGAAAAGGAAGGTGGAAGG + Intergenic
981534388 4:145784026-145784048 AGTAGGAATAGAGAAGGGGAAGG - Intronic
981572872 4:146172054-146172076 AGAAGGAAAAGAAAGAGGGAGGG - Intergenic
981777738 4:148389308-148389330 TGTAGGAATAGAAAGATGGCAGG + Intronic
981885181 4:149665825-149665847 AGCAGGTGGAGAAAGGTGGAAGG + Intergenic
982012674 4:151121835-151121857 AGTGGGATTAGCAAGGTGAAGGG - Exonic
982114360 4:152085162-152085184 AGGAGGACTAGAATGGTGGAGGG - Intergenic
982227629 4:153180859-153180881 AGTATGAATGGATGGGTGGATGG - Intronic
982300817 4:153877947-153877969 AGGAGGAAGAGAAAGCAGGAGGG + Intergenic
983083094 4:163412106-163412128 AGAAGGAAGGTAAAGGTGGAGGG + Intergenic
983141270 4:164152611-164152633 AGAAGGAAAACAAAGGGGGAAGG - Intronic
983274930 4:165605338-165605360 AGGAGGAAAAGAAAGAGGGAAGG - Intergenic
985525726 5:400578-400600 TGTAGGATTAGAAAGGCAGAGGG + Intronic
985929619 5:3046967-3046989 ATTAGGAAGAGAAGGGTGGGTGG + Intergenic
986596581 5:9429097-9429119 AGAAGGAAGAGAAAGGTTCATGG + Intronic
987063572 5:14266047-14266069 AAAAGGAAAAGAAAGATGGATGG - Intronic
987558805 5:19490794-19490816 AGTAGGAGTAAAAAGGTGAGAGG + Intronic
988393745 5:30669757-30669779 AGCAGGAAGAGGAAGTTGGAAGG + Intergenic
989105103 5:37855619-37855641 AGTAGAAATAGAAAGTAGAAAGG - Intergenic
989517672 5:42362395-42362417 GGTAGGAATAGATAGTTGGAAGG - Intergenic
989775784 5:45205715-45205737 AGTAGTAAGAGAGAGGGGGAAGG - Intergenic
990875956 5:60486037-60486059 TGAAGGCATAAAAAGGTGGAAGG + Intronic
990973520 5:61536243-61536265 GGTAGAAATAAAAAGGTGGGTGG - Intronic
992319713 5:75601565-75601587 AGCAGGCAGAGGAAGGTGGAAGG + Intergenic
992744563 5:79806488-79806510 AGGAGGAATAGAAAGGAAGGAGG + Intergenic
993175765 5:84483059-84483081 AAAAGGAACAGAAAGGAGGAAGG + Intergenic
993754724 5:91714328-91714350 AGAAGCAAGAGAAAGGTGGAGGG + Intergenic
993904004 5:93603891-93603913 AGGCGGAATGGAAAGGAGGAGGG + Intergenic
994326814 5:98457241-98457263 AGTAGGAAGGAAAAGGTAGAGGG - Intergenic
994833270 5:104813577-104813599 AGTTGGAAGAGGAAGGTGGGAGG - Intergenic
995129589 5:108615920-108615942 AGGAAGAAAAGAAAGGAGGAAGG + Intergenic
995419924 5:111952878-111952900 AGTAGGAATGGGAATGTGAAAGG + Intronic
995461667 5:112410249-112410271 AGAAAGAATAGAAAGGAGGTTGG + Intronic
996674590 5:126159239-126159261 AGGAGGAAGAGAGAGGGGGATGG + Intergenic
996827429 5:127701191-127701213 AGTAGGATCAGAAAGGGGAATGG - Intergenic
997804639 5:136905091-136905113 AGGAGGAAGAGAAAGATGAAGGG - Intergenic
998233498 5:140377680-140377702 AATAGAAATAGAAAATTGGAGGG - Intergenic
999530654 5:152459673-152459695 AGGAGGAATAGAAAGATAGAAGG + Intergenic
999790296 5:154933850-154933872 AGGATGAACAGAAAGGTGGTAGG - Intronic
1000287739 5:159841906-159841928 AGTAAGAATGAAGAGGTGGATGG - Intergenic
1000434207 5:161188052-161188074 AGTAGGCATAAAAAGCTGCAAGG - Intergenic
1001241953 5:170077924-170077946 AGGAGGAAGGGAAAGGTAGAAGG - Intronic
1001306582 5:170578897-170578919 AGAAGGAATAGCAAGAGGGAGGG + Intronic
1001320927 5:170680884-170680906 AGGAGGAGGAGAGAGGTGGAGGG + Intronic
1001877396 5:175213377-175213399 AGCAGGAATGGATGGGTGGAAGG - Intergenic
1001966048 5:175910623-175910645 ACTGGGGATAGAAAGGTGGATGG - Intergenic
1001970331 5:175950152-175950174 ATTAGGCCTTGAAAGGTGGAAGG - Intronic
1001987782 5:176090190-176090212 AGAAGGAAGAGAAAGAAGGAAGG + Intronic
1002229088 5:177747962-177747984 AGAAGGAAGAGAAAGAAGGAAGG - Intronic
1002247108 5:177893609-177893631 ATTAGGCCTTGAAAGGTGGAAGG + Intergenic
1002250898 5:177928577-177928599 ACTGGGGATAGAAAGGTGGATGG + Intergenic
1002266258 5:178035821-178035843 AGAAGGAAGAGAAAGAAGGAAGG + Intronic
1002834855 6:857487-857509 TGGAGGAATGGATAGGTGGATGG - Intergenic
1003252987 6:4448251-4448273 AAAAGGAATAGAAAGGAAGATGG - Intergenic
1003364536 6:5459784-5459806 GGAAGAAATAGGAAGGTGGAGGG - Intronic
1004365568 6:15009663-15009685 ACGAGGAAGAGAAAGGAGGACGG - Intergenic
1005173456 6:23015061-23015083 AGGAGGAAGTGGAAGGTGGAAGG + Intergenic
1006956724 6:37880098-37880120 AGTATTAAAAGAAAGGTGAATGG + Intronic
1007554345 6:42753562-42753584 AGTAGTTATAGATAGGAGGAGGG + Intronic
1007770094 6:44185303-44185325 AGTATGAAAAGAAAGCTGTAAGG + Intergenic
1008340188 6:50355003-50355025 AGCAAGAAGAGAAATGTGGAAGG + Intergenic
1008482779 6:52004096-52004118 AGAAGGAAAAGAGAGGTAGAAGG - Intronic
1009315453 6:62213494-62213516 AGCAGGGATAGAATGTTGGAAGG + Intronic
1009418044 6:63437103-63437125 AGAAGGAAAAGAAAGGGAGAAGG + Intergenic
1009590934 6:65670087-65670109 AGGAGAAACAGAAAGGTGCAGGG - Intronic
1009911624 6:69937136-69937158 AGAATGAATAGAAAAGTGAAGGG + Intronic
1010065376 6:71676444-71676466 AGTAGGTAAACAAAGTTGGAAGG - Intergenic
1010143657 6:72640675-72640697 AATAGGATTAGAGAGCTGGAAGG + Intronic
1010308575 6:74354711-74354733 AGTAAGAAGAGAATTGTGGAAGG + Intergenic
1010566208 6:77417484-77417506 AGTAAAAACAGAAAGATGGAGGG - Intergenic
1010903790 6:81460436-81460458 AGTAGGACTAGAAGTGTGGCTGG + Intergenic
1012012252 6:93804301-93804323 AAAAGGAAGAGAAAGGTGGAAGG - Intergenic
1012165680 6:95948102-95948124 AGGAGGAGGAGAAAGGAGGAAGG + Intergenic
1012529481 6:100217292-100217314 AGTAGGCACAAAGAGGTGGAGGG - Intergenic
1012564186 6:100625501-100625523 AATAGGAAAAGAAAGGTTGATGG + Intronic
1012628436 6:101432513-101432535 TGTAGGAATACAAAGATGAATGG + Intronic
1013568314 6:111392972-111392994 CCTAGGAATAGAAAGGTAAAAGG + Exonic
1013760496 6:113511893-113511915 AGGAGGCTGAGAAAGGTGGATGG + Intergenic
1013887499 6:114987994-114988016 AGCAGGCAGAGGAAGGTGGAAGG + Intergenic
1013945592 6:115718566-115718588 AGTAGGAAGTGAATGGTGAATGG - Intergenic
1014154934 6:118099486-118099508 AGAAGGAAGAGAGAGGAGGAGGG - Intronic
1014762962 6:125378033-125378055 AGTAGGGAGCGAAATGTGGATGG + Intergenic
1015324886 6:131913678-131913700 ACTAGCAATGGAAATGTGGAAGG - Intergenic
1016504912 6:144768251-144768273 AATAATAATAGATAGGTGGAAGG + Intronic
1017920218 6:158865237-158865259 AGTAGGTGTGCAAAGGTGGAAGG - Intergenic
1018038077 6:159898658-159898680 AGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1018178270 6:161197676-161197698 AGAAGGACTGGACAGGTGGAAGG + Intronic
1018453772 6:163933664-163933686 AGAAGGAATAGAAACATAGAAGG + Intergenic
1019345552 7:528387-528409 TGGATGAATAGAAAGATGGATGG + Intergenic
1019380991 7:723438-723460 TGGAGGAATAGCAAGGTGGTGGG - Intronic
1019438579 7:1034766-1034788 AGGAGGAAAAGGAGGGTGGAGGG - Intronic
1019549557 7:1595183-1595205 AGGATGAATAGATAGATGGATGG - Intergenic
1020355819 7:7274466-7274488 AGGAGGCAGAGAAAGTTGGAAGG + Intergenic
1020795293 7:12671566-12671588 AGGAGGAAGAGAGAGGGGGAAGG - Intergenic
1021862095 7:24915934-24915956 ATTAGGAATAAATAGGTGGAGGG + Intronic
1023119765 7:36897568-36897590 AGTAGGAGAAGGAAGCTGGATGG + Intronic
1023444517 7:40217657-40217679 TGTAGAAACAGAAAAGTGGATGG + Intronic
1023771602 7:43561629-43561651 AGAATGAATAGACTGGTGGAAGG - Intronic
1024787059 7:52920448-52920470 AGTAGGAAAAGAAAGGCTCAAGG - Intergenic
1024907166 7:54398752-54398774 AATAGGAAGAGAAAGGAGGGAGG - Intergenic
1025992871 7:66508767-66508789 AGAAAGAAAAGAAAGGAGGAAGG - Intergenic
1026679923 7:72458051-72458073 ACTAAGAATAGGAAGGTGGCTGG - Intergenic
1027137031 7:75631809-75631831 AGAAGGGAGACAAAGGTGGAGGG + Intronic
1027160691 7:75800129-75800151 AGGAGGAATCTAAAGATGGAGGG - Intergenic
1027447039 7:78286208-78286230 AGGAGGAATAGAGAGAGGGAGGG - Intronic
1028069519 7:86434053-86434075 AATACCAATAGAAAGATGGAGGG + Intergenic
1028433526 7:90775651-90775673 AGGAGGAGGAGAAAGGGGGAGGG - Intronic
1028959481 7:96732735-96732757 AGGAGGAAAAGAAAGGTAGGGGG - Intergenic
1029174815 7:98657219-98657241 ATGATGAATAGATAGGTGGATGG + Intergenic
1030486801 7:110179074-110179096 AGAGGGAAAAGAAAGGAGGAAGG + Intergenic
1032061864 7:128731397-128731419 AGTAGGACCAGAGAAGTGGAAGG + Exonic
1032523310 7:132562086-132562108 AGGAGGAGGAGAAAGGAGGAGGG - Intronic
1032744935 7:134776734-134776756 AGTAGGCATTTTAAGGTGGAAGG + Intronic
1033649029 7:143326642-143326664 AGTAGGACTGGCAAGGAGGATGG + Intronic
1034455759 7:151168696-151168718 AATAGGAATAGAAACGAGGACGG - Intronic
1035284727 7:157799009-157799031 AGTTGGAGAAGAAAGGAGGAGGG - Intronic
1035339449 7:158151127-158151149 GGCAGGAATAGAAAGGCGGGCGG - Intronic
1035339516 7:158151384-158151406 GGCAGGAATAGAAAGGCGGGCGG - Intronic
1035339526 7:158151421-158151443 GGCAGGAATAGAAAGGCGGGCGG - Intronic
1035339536 7:158151458-158151480 GGCAGGAATAGAAAGGCGGGTGG - Intronic
1035673272 8:1436385-1436407 AGCAGGCAGAGGAAGGTGGAAGG - Intergenic
1035777151 8:2196786-2196808 AGCAGGCAGAGGAAGGTGGAAGG - Intergenic
1036111414 8:5907150-5907172 TGGAGGAATAGAGAGATGGAGGG - Intergenic
1036151119 8:6299646-6299668 AGAAGAAATAGAAAAGTTGAGGG - Intergenic
1036567119 8:9947157-9947179 AGCAGAAATAGATAAGTGGAAGG + Intergenic
1036589286 8:10153334-10153356 AGGAGGGAAAGGAAGGTGGAAGG - Intronic
1036591811 8:10175058-10175080 AGTAGAACCAGAAATGTGGATGG - Intronic
1036762414 8:11518533-11518555 AGTGGAAATAGAGAAGTGGATGG - Intronic
1037367088 8:18134681-18134703 AGGAGGTGTAGAAGGGTGGAGGG + Intergenic
1038124735 8:24660414-24660436 AGCAGCTATAAAAAGGTGGAAGG - Intergenic
1038947031 8:32372709-32372731 AGTAGGAAGTGAAAGTTGGGAGG - Intronic
1040838848 8:51762351-51762373 GGAAGGAATACAAAGGGGGAAGG - Intronic
1041144797 8:54862631-54862653 TGGAAGAATAGCAAGGTGGAAGG - Intergenic
1041470986 8:58208846-58208868 AGTGAGAAGAGAGAGGTGGAGGG - Intergenic
1041527261 8:58821295-58821317 AGTAGGTATAGAAAGGAGGGGGG - Intronic
1041625849 8:60025773-60025795 AGGAGGAAGAGCAAGGTGGCTGG - Intergenic
1041860804 8:62510613-62510635 AGGAGGAAGAGGAAGGAGGAAGG + Intronic
1041865321 8:62566398-62566420 ACTAGGAGTACAAAGGTGAATGG - Intronic
1042171941 8:66000111-66000133 AGAAGGAAGAGAAAGAAGGAAGG - Intergenic
1042572347 8:70179415-70179437 AGGAGGAAAAGAAGGGAGGAAGG + Intronic
1043777258 8:84285723-84285745 TGGAGGAATAGAAAGGAGGTTGG + Intronic
1044423907 8:92029480-92029502 AGTAGGAACCGAGAGGTGCATGG + Intronic
1045771771 8:105749743-105749765 AGAAAGAAAGGAAAGGTGGAAGG + Intronic
1045957032 8:107920116-107920138 AGGAGGAAGAGAAAGAAGGAGGG + Intronic
1046848242 8:118942985-118943007 AGTATGAGTAGATAGGTGGATGG - Intronic
1048734753 8:137486837-137486859 AGAAGGAAAAGAAAGAAGGAGGG - Intergenic
1048744103 8:137593937-137593959 TGTAGGATTACAAATGTGGAGGG - Intergenic
1048913338 8:139157819-139157841 AGAAGGAATGGAAGGGTGGCAGG + Intergenic
1049469259 8:142768200-142768222 AGGAGGAATAGAGAGGAGGAGGG + Intronic
1050060706 9:1706798-1706820 GGTAGGAAAACAAAGGGGGAAGG - Intergenic
1050222532 9:3409956-3409978 AATAGGAGAAGAAAGGAGGAAGG + Intronic
1050235708 9:3577239-3577261 AATAAGACTAGAAAAGTGGAAGG + Intergenic
1050471833 9:6001178-6001200 AGTAGGAATAGAAAGGTGGATGG - Intronic
1051129270 9:13841342-13841364 AGGAGGGAGAGAAAGGAGGAGGG + Intergenic
1051517822 9:17950460-17950482 AGTATAAAAAGAGAGGTGGAAGG - Intergenic
1051921311 9:22269270-22269292 AGAAGGAATAGAAAAGTACAAGG - Intergenic
1051982822 9:23045418-23045440 ACTAGGTAAAGAAAGGGGGAGGG + Intergenic
1052062212 9:23974361-23974383 ATTATGCATAAAAAGGTGGAGGG - Intergenic
1052254352 9:26436842-26436864 AGTAGGAATTGCCAGGTGGTAGG - Intergenic
1052469154 9:28871409-28871431 AATAGGAATGGAAAGTGGGAGGG + Intergenic
1052506902 9:29366943-29366965 AGTAGGGATAGCAAGGTCAAGGG - Intergenic
1052789436 9:32860908-32860930 AGCAGGCAGAAAAAGGTGGAAGG - Intergenic
1052830868 9:33214350-33214372 AGAATGAATGGAAAGATGGAGGG + Intergenic
1053562395 9:39209865-39209887 AGAGGGACTAGAAAGGAGGAGGG + Intronic
1053828201 9:42047857-42047879 AGAGGGACTAGAAAGGAGGAGGG + Intronic
1054134756 9:61409174-61409196 AGAGGGACTAGAAAGGAGGAGGG - Intergenic
1054602358 9:67139597-67139619 AGAGGGACTAGAAAGGAGGAGGG - Intergenic
1055136085 9:72830818-72830840 AGAAGGGCTAAAAAGGTGGAAGG - Intronic
1055233700 9:74092577-74092599 AGTAGGAAAAGAGGTGTGGATGG - Intergenic
1055270329 9:74550589-74550611 AGTGGTAATTGAAAGGTGGAAGG - Intronic
1055552790 9:77446583-77446605 AATGGGAAAAGAAAGATGGAGGG - Intronic
1055748962 9:79483256-79483278 AGAAGGAACAAAAAGGTGAAAGG - Intergenic
1057933166 9:99213383-99213405 AGTAGAAGTATTAAGGTGGAGGG + Intergenic
1058035872 9:100252059-100252081 AGCAAGAAGAGAAAGGTAGAAGG + Intronic
1058057535 9:100464179-100464201 ACTTGGCATATAAAGGTGGAAGG - Intronic
1058225159 9:102351237-102351259 AGAAAGAATATAAATGTGGATGG + Intergenic
1059231657 9:112726372-112726394 AGTAGGAACAGAAAGGAGCCAGG - Intergenic
1059583651 9:115580666-115580688 AATAGAAATAGATAGATGGATGG - Intergenic
1060259837 9:122064760-122064782 AGTAAGAAGACAAAGGAGGAGGG + Intronic
1060315148 9:122502886-122502908 ACTAGGAACTGAAAAGTGGAAGG - Intergenic
1061244909 9:129396563-129396585 AGGATGGATAGAAAGATGGATGG + Intergenic
1061245122 9:129397615-129397637 AGGAAGAATAGGAGGGTGGATGG + Intergenic
1062110730 9:134780775-134780797 AGTGAGAAGAGAAAGGTGGCCGG - Intronic
1062201720 9:135306251-135306273 AGGAGGAAAGGAAAGGAGGAAGG - Intergenic
1185780545 X:2840682-2840704 GGTAGGTATAGATAGATGGATGG + Intronic
1186858295 X:13646777-13646799 AGCAGGAATGTACAGGTGGAGGG + Intergenic
1187845159 X:23527533-23527555 AGGAGGAAAAGAAAGAAGGAAGG + Intergenic
1187970553 X:24654071-24654093 AGAAAGAAAAGAAACGTGGAAGG - Intronic
1188047361 X:25441722-25441744 AGTAGGAATAGAGGGGAGGAGGG + Intergenic
1189745929 X:44168711-44168733 TCTAGGAATAGAAAAGGGGAAGG - Intronic
1191884987 X:65879074-65879096 AGGAGGACTAGACAGGTGTATGG + Intergenic
1195247946 X:103013431-103013453 ATTATGAGAAGAAAGGTGGACGG - Intergenic
1195740292 X:108058517-108058539 AATAGGGAGATAAAGGTGGAGGG - Intronic
1196036586 X:111151508-111151530 AGAAGGAATGGAAAGGAGGTAGG + Intronic
1196598628 X:117574952-117574974 TGAAGGTATAGAAAGGTGAAAGG - Intergenic
1198666280 X:139026699-139026721 AGTAGCAATAAAGAGGTGGGAGG + Intronic
1198812361 X:140548543-140548565 AGAAGGAAGAGAGAGGAGGAGGG + Intergenic
1199523374 X:148763620-148763642 AGAAAGAATAGAAAGGTAGGTGG + Intronic
1200258697 X:154600031-154600053 AGGGGGAAGAGCAAGGTGGAGGG + Intergenic
1200766888 Y:7087765-7087787 AAGAGGAAGAGGAAGGTGGAAGG - Intronic