ID: 1050475369

View in Genome Browser
Species Human (GRCh38)
Location 9:6034989-6035011
Sequence AATGGCTGTGCAGTGGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050475369_1050475376 3 Left 1050475369 9:6034989-6035011 CCTCTCCCCACTGCACAGCCATT No data
Right 1050475376 9:6035015-6035037 ATGAGAGTATTGGCAGCACAGGG No data
1050475369_1050475375 2 Left 1050475369 9:6034989-6035011 CCTCTCCCCACTGCACAGCCATT No data
Right 1050475375 9:6035014-6035036 CATGAGAGTATTGGCAGCACAGG No data
1050475369_1050475373 -7 Left 1050475369 9:6034989-6035011 CCTCTCCCCACTGCACAGCCATT No data
Right 1050475373 9:6035005-6035027 AGCCATTGTCATGAGAGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050475369 Original CRISPR AATGGCTGTGCAGTGGGGAG AGG (reversed) Intergenic
No off target data available for this crispr