ID: 1050475373

View in Genome Browser
Species Human (GRCh38)
Location 9:6035005-6035027
Sequence AGCCATTGTCATGAGAGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050475368_1050475373 -6 Left 1050475368 9:6034988-6035010 CCCTCTCCCCACTGCACAGCCAT No data
Right 1050475373 9:6035005-6035027 AGCCATTGTCATGAGAGTATTGG No data
1050475363_1050475373 4 Left 1050475363 9:6034978-6035000 CCCCGCTTCCCCCTCTCCCCACT No data
Right 1050475373 9:6035005-6035027 AGCCATTGTCATGAGAGTATTGG No data
1050475365_1050475373 2 Left 1050475365 9:6034980-6035002 CCGCTTCCCCCTCTCCCCACTGC No data
Right 1050475373 9:6035005-6035027 AGCCATTGTCATGAGAGTATTGG No data
1050475367_1050475373 -5 Left 1050475367 9:6034987-6035009 CCCCTCTCCCCACTGCACAGCCA No data
Right 1050475373 9:6035005-6035027 AGCCATTGTCATGAGAGTATTGG No data
1050475361_1050475373 27 Left 1050475361 9:6034955-6034977 CCAGTGCTGCCAGAGTGAGTGCA No data
Right 1050475373 9:6035005-6035027 AGCCATTGTCATGAGAGTATTGG No data
1050475364_1050475373 3 Left 1050475364 9:6034979-6035001 CCCGCTTCCCCCTCTCCCCACTG No data
Right 1050475373 9:6035005-6035027 AGCCATTGTCATGAGAGTATTGG No data
1050475369_1050475373 -7 Left 1050475369 9:6034989-6035011 CCTCTCCCCACTGCACAGCCATT No data
Right 1050475373 9:6035005-6035027 AGCCATTGTCATGAGAGTATTGG No data
1050475366_1050475373 -4 Left 1050475366 9:6034986-6035008 CCCCCTCTCCCCACTGCACAGCC No data
Right 1050475373 9:6035005-6035027 AGCCATTGTCATGAGAGTATTGG No data
1050475362_1050475373 18 Left 1050475362 9:6034964-6034986 CCAGAGTGAGTGCACCCCGCTTC No data
Right 1050475373 9:6035005-6035027 AGCCATTGTCATGAGAGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050475373 Original CRISPR AGCCATTGTCATGAGAGTAT TGG Intergenic