ID: 1050475376

View in Genome Browser
Species Human (GRCh38)
Location 9:6035015-6035037
Sequence ATGAGAGTATTGGCAGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050475368_1050475376 4 Left 1050475368 9:6034988-6035010 CCCTCTCCCCACTGCACAGCCAT No data
Right 1050475376 9:6035015-6035037 ATGAGAGTATTGGCAGCACAGGG No data
1050475365_1050475376 12 Left 1050475365 9:6034980-6035002 CCGCTTCCCCCTCTCCCCACTGC No data
Right 1050475376 9:6035015-6035037 ATGAGAGTATTGGCAGCACAGGG No data
1050475362_1050475376 28 Left 1050475362 9:6034964-6034986 CCAGAGTGAGTGCACCCCGCTTC No data
Right 1050475376 9:6035015-6035037 ATGAGAGTATTGGCAGCACAGGG No data
1050475369_1050475376 3 Left 1050475369 9:6034989-6035011 CCTCTCCCCACTGCACAGCCATT No data
Right 1050475376 9:6035015-6035037 ATGAGAGTATTGGCAGCACAGGG No data
1050475370_1050475376 -2 Left 1050475370 9:6034994-6035016 CCCCACTGCACAGCCATTGTCAT No data
Right 1050475376 9:6035015-6035037 ATGAGAGTATTGGCAGCACAGGG No data
1050475364_1050475376 13 Left 1050475364 9:6034979-6035001 CCCGCTTCCCCCTCTCCCCACTG No data
Right 1050475376 9:6035015-6035037 ATGAGAGTATTGGCAGCACAGGG No data
1050475366_1050475376 6 Left 1050475366 9:6034986-6035008 CCCCCTCTCCCCACTGCACAGCC No data
Right 1050475376 9:6035015-6035037 ATGAGAGTATTGGCAGCACAGGG No data
1050475372_1050475376 -4 Left 1050475372 9:6034996-6035018 CCACTGCACAGCCATTGTCATGA No data
Right 1050475376 9:6035015-6035037 ATGAGAGTATTGGCAGCACAGGG No data
1050475367_1050475376 5 Left 1050475367 9:6034987-6035009 CCCCTCTCCCCACTGCACAGCCA No data
Right 1050475376 9:6035015-6035037 ATGAGAGTATTGGCAGCACAGGG No data
1050475363_1050475376 14 Left 1050475363 9:6034978-6035000 CCCCGCTTCCCCCTCTCCCCACT No data
Right 1050475376 9:6035015-6035037 ATGAGAGTATTGGCAGCACAGGG No data
1050475371_1050475376 -3 Left 1050475371 9:6034995-6035017 CCCACTGCACAGCCATTGTCATG No data
Right 1050475376 9:6035015-6035037 ATGAGAGTATTGGCAGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050475376 Original CRISPR ATGAGAGTATTGGCAGCACA GGG Intergenic