ID: 1050476272

View in Genome Browser
Species Human (GRCh38)
Location 9:6044773-6044795
Sequence GTTCTCAGTGAAACACACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050476265_1050476272 5 Left 1050476265 9:6044745-6044767 CCCAGCCTTGACAGAAATGGCTG No data
Right 1050476272 9:6044773-6044795 GTTCTCAGTGAAACACACTGAGG No data
1050476271_1050476272 0 Left 1050476271 9:6044750-6044772 CCTTGACAGAAATGGCTGGGGGA No data
Right 1050476272 9:6044773-6044795 GTTCTCAGTGAAACACACTGAGG No data
1050476262_1050476272 24 Left 1050476262 9:6044726-6044748 CCCAATGGTGGGCAGAGGTCCCA No data
Right 1050476272 9:6044773-6044795 GTTCTCAGTGAAACACACTGAGG No data
1050476263_1050476272 23 Left 1050476263 9:6044727-6044749 CCAATGGTGGGCAGAGGTCCCAG No data
Right 1050476272 9:6044773-6044795 GTTCTCAGTGAAACACACTGAGG No data
1050476266_1050476272 4 Left 1050476266 9:6044746-6044768 CCAGCCTTGACAGAAATGGCTGG No data
Right 1050476272 9:6044773-6044795 GTTCTCAGTGAAACACACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050476272 Original CRISPR GTTCTCAGTGAAACACACTG AGG Intergenic
No off target data available for this crispr