ID: 1050478740

View in Genome Browser
Species Human (GRCh38)
Location 9:6067779-6067801
Sequence CAGGTTGGGGAACCTGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050478734_1050478740 8 Left 1050478734 9:6067748-6067770 CCAAAGAGGGATGACAGCTGAGG No data
Right 1050478740 9:6067779-6067801 CAGGTTGGGGAACCTGTTCCTGG No data
1050478733_1050478740 9 Left 1050478733 9:6067747-6067769 CCCAAAGAGGGATGACAGCTGAG No data
Right 1050478740 9:6067779-6067801 CAGGTTGGGGAACCTGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050478740 Original CRISPR CAGGTTGGGGAACCTGTTCC TGG Intergenic
No off target data available for this crispr