ID: 1050480414

View in Genome Browser
Species Human (GRCh38)
Location 9:6081920-6081942
Sequence GGTGGGACTCAAAATAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050480414_1050480420 1 Left 1050480414 9:6081920-6081942 CCTCTTTTATTTTGAGTCCCACC No data
Right 1050480420 9:6081944-6081966 GGAGCCCTTGATAAATTTGGAGG 0: 12
1: 8
2: 19
3: 32
4: 121
1050480414_1050480422 5 Left 1050480414 9:6081920-6081942 CCTCTTTTATTTTGAGTCCCACC No data
Right 1050480422 9:6081948-6081970 CCCTTGATAAATTTGGAGGTAGG 0: 12
1: 23
2: 24
3: 36
4: 177
1050480414_1050480419 -2 Left 1050480414 9:6081920-6081942 CCTCTTTTATTTTGAGTCCCACC No data
Right 1050480419 9:6081941-6081963 CCAGGAGCCCTTGATAAATTTGG 0: 12
1: 7
2: 2
3: 10
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050480414 Original CRISPR GGTGGGACTCAAAATAAAAG AGG (reversed) Intergenic
No off target data available for this crispr