ID: 1050480419

View in Genome Browser
Species Human (GRCh38)
Location 9:6081941-6081963
Sequence CCAGGAGCCCTTGATAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 12, 1: 7, 2: 2, 3: 10, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050480410_1050480419 29 Left 1050480410 9:6081889-6081911 CCGAAGAACAATAGGGGAGTCAG No data
Right 1050480419 9:6081941-6081963 CCAGGAGCCCTTGATAAATTTGG 0: 12
1: 7
2: 2
3: 10
4: 95
1050480414_1050480419 -2 Left 1050480414 9:6081920-6081942 CCTCTTTTATTTTGAGTCCCACC No data
Right 1050480419 9:6081941-6081963 CCAGGAGCCCTTGATAAATTTGG 0: 12
1: 7
2: 2
3: 10
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050480419 Original CRISPR CCAGGAGCCCTTGATAAATT TGG Intergenic
901158122 1:7154325-7154347 CCTGGAGTCATTGATAAATGAGG + Intronic
903445228 1:23418699-23418721 CCAGGAGCTTTTGGTAAATCTGG + Intronic
905762143 1:40568332-40568354 CTAAGAGCTCTTGATAAATAAGG - Intergenic
909551485 1:76902751-76902773 CATGGTGCCCTTGTTAAATTCGG - Intronic
910470744 1:87549900-87549922 CCAAGAGCTCTTGCAAAATTTGG + Intergenic
912812489 1:112804584-112804606 CCAGGTGCTTTTGATAAGTTTGG - Intergenic
913392320 1:118327990-118328012 CCATTAACCCATGATAAATTAGG + Intergenic
916034254 1:160906848-160906870 GCAGCAGCCCTTGCAAAATTTGG + Intergenic
917312075 1:173689035-173689057 GCAGGAGCCCTTGATAAATTTGG - Intergenic
918105850 1:181414511-181414533 CCAGGAGCCCGGCATACATTCGG - Intronic
922082968 1:222315778-222315800 CAAAGAGCCCTTGAGGAATTTGG - Intergenic
922896292 1:229102961-229102983 CCATGACCCCTGGATAAAATGGG + Intergenic
1063748234 10:8911643-8911665 AAACGAGTCCTTGATAAATTTGG - Intergenic
1067193212 10:44090040-44090062 CTAGAAACCCTTGACAAATTTGG - Intergenic
1069168362 10:65192915-65192937 CCATGTGCACTTGATAAATCAGG - Intergenic
1070992142 10:80741799-80741821 CCAGGAGCCCATGATAAATTTGG + Intergenic
1071147512 10:82592231-82592253 CCAGAATCCCTTAATAAATGTGG - Intronic
1071918666 10:90325192-90325214 TCAGAATCCCTTGAGAAATTTGG - Intergenic
1074032630 10:109703954-109703976 CCAGGAGGCCTTGGTAAATCAGG - Intergenic
1082801200 11:57416228-57416250 CCAGGAGACCTGGAGAAATGGGG + Intronic
1089318727 11:117610510-117610532 CCATGAGCCCTTGCTACATTTGG - Intronic
1089374428 11:117984546-117984568 CAAGGAGCAATTGATAAATTGGG - Intergenic
1090001265 11:122960965-122960987 ACAAGAGCACATGATAAATTGGG + Intergenic
1090323999 11:125869388-125869410 CCAGGAGCCCTTGATAAATTTGG - Intergenic
1091202355 11:133791537-133791559 AGAGAAGCCCATGATAAATTTGG + Intergenic
1097940704 12:65302184-65302206 TTTGGAGCCCTTGATAATTTTGG + Intronic
1102526110 12:113513580-113513602 CCAAAACCCCTTGTTAAATTAGG - Intergenic
1102605935 12:114067203-114067225 TCAGAAGCCTTTGATAAATTTGG + Intergenic
1103202212 12:119097009-119097031 CCGGGAGGCCTTGAGGAATTCGG + Intronic
1111399758 13:87719325-87719347 CCACCAGCCCTTGAAAGATTCGG - Intergenic
1113525061 13:110968150-110968172 CCAGGAGCCCCTGATAAATTTGG + Intergenic
1116833471 14:49745863-49745885 TCAAGAGCCATTGAAAAATTTGG + Intronic
1120106357 14:80499956-80499978 CCAGCAGGCCAGGATAAATTTGG + Intronic
1125183273 15:36901854-36901876 CCAGGAGCCCTTGTAACTTTAGG - Intronic
1129164395 15:73768102-73768124 CCAGGGGGCCTTGGTGAATTAGG + Intergenic
1131404946 15:92156526-92156548 CCTGGACCCCTTGTTAAAGTTGG - Intronic
1134435385 16:14251927-14251949 CCAGCAGCCCTTTATCAATAAGG + Exonic
1140119000 16:72067206-72067228 CCAGGAGCCCTTGATAAATTTGG + Intronic
1141610800 16:85180155-85180177 CGTGGAGCCCTTGATTAAATCGG + Intronic
1144535391 17:16084022-16084044 CCAGGTGCCCATGAAAAAGTGGG + Intronic
1148148664 17:45382953-45382975 CCAAGAGTTCTTGATATATTTGG + Intergenic
1150655194 17:67034587-67034609 CCAGGAAGCATTGATAGATTGGG - Intergenic
1154935009 18:21045861-21045883 CAAGAAGTCTTTGATAAATTTGG + Intronic
1162268298 19:9594193-9594215 CCAGGAGCCCTTGATCAATTTGG - Intergenic
1165971005 19:39629790-39629812 ACAGGAGCCCTGGATAATTCTGG - Intergenic
925703553 2:6662668-6662690 CATGGAGCCATTGATGAATTAGG - Intergenic
930737268 2:54792270-54792292 CCAGGGGGCATTAATAAATTAGG - Intronic
931274838 2:60735577-60735599 CCAGGAACCCATAAAAAATTAGG + Intergenic
933389914 2:81655806-81655828 CCAGGAGCCCTTGATAAATTTGG - Intergenic
935048093 2:99499563-99499585 CCAGGAGCCCTTGATAAATTTGG + Intergenic
935476205 2:103527227-103527249 CTAGGAGCCTTTGAGAAATTTGG + Intergenic
936224946 2:110640360-110640382 CCAGGAGCCCATGGTAAAAGGGG - Intronic
937589395 2:123594929-123594951 CCACAGGACCTTGATAAATTAGG + Intergenic
938789373 2:134663294-134663316 CCAGCAGGCCTTGAAATATTAGG - Intronic
940590088 2:155712451-155712473 CCAGGTGCATTTGATAAAATAGG - Intergenic
943326833 2:186509729-186509751 CTAAGAGCCCCTGAAAAATTAGG + Intergenic
947595604 2:231409759-231409781 CCAGCAGCCCTTGGTATATGTGG - Intergenic
1168823733 20:794587-794609 CCAGGAGCCCTTGATAAATTTGG + Intergenic
1172346134 20:34201605-34201627 CCAGCTGCCTTTGATAGATTCGG + Intronic
1177124752 21:17182025-17182047 CCAGGAGCTCCAGATAATTTTGG + Intergenic
1180992496 22:19945318-19945340 CAAAGAGCTCTTGAAAAATTTGG - Intronic
1182477360 22:30583389-30583411 CCTGGAGCCCCTGATAATCTGGG + Intronic
950846583 3:16021480-16021502 CCAGGAGCCCTTGATAAATTTGG - Intergenic
955882429 3:63561848-63561870 TCAGTAGCCATTGATAAACTTGG - Intronic
956505556 3:69934947-69934969 CCAGCTACCCTTGAAAAATTTGG + Intronic
960291878 3:115895740-115895762 CAAGGAGCCCTGGATAAATATGG - Intronic
961030338 3:123597610-123597632 ACAGGAGCCCTGTAAAAATTAGG + Intergenic
962292072 3:134145609-134145631 CTAGGAGCCCTGGATAGATTTGG + Intronic
965561638 3:170067444-170067466 CCAGGAGCTCTTTATAAATTAGG + Intronic
969416829 4:7066112-7066134 CCAGGACCTCTTTTTAAATTAGG + Intronic
970438707 4:16060935-16060957 CCAGGAGCCCTTGTCACCTTTGG + Intronic
970847426 4:20557388-20557410 CCTAGAGCCCTTGATAATTACGG + Intronic
971036005 4:22693469-22693491 CAAAGAGCCCTTCATTAATTGGG + Intergenic
973529076 4:51817643-51817665 CCAGGAGCCCTTAATAAATTTGG - Intergenic
975048329 4:69829876-69829898 CCAGGAGCCTATGATCACTTTGG - Intronic
977374332 4:96182041-96182063 CCATGAGCCCTTGAAAAGTGGGG + Intergenic
977609696 4:99019287-99019309 TCAAGAGCCCTTGATAAATTTGG - Intronic
978310758 4:107382705-107382727 CCAGGAGCCCTTGATAAATTTGG + Intergenic
981365996 4:143903828-143903850 CCAGGAACCCTTTCCAAATTTGG + Intronic
981376110 4:144017638-144017660 CCAGGAACCCTTTCCAAATTTGG + Intronic
981386626 4:144138980-144139002 CCAGGAACCCTTTCCAAATTTGG + Intronic
984705203 4:182842585-182842607 TCCAGAGCCCTTGATAAATTAGG - Intergenic
986629623 5:9758244-9758266 CCAGGAGATATTAATAAATTAGG - Intergenic
987833238 5:23125911-23125933 CCAAGAGCCATTGATTGATTTGG + Intergenic
989615494 5:43333769-43333791 CCAGGAGCCCTTGATAAATTTGG - Intergenic
991937740 5:71818453-71818475 CCAAGAGCCCTTGAAAAATGCGG + Intergenic
993813851 5:92516413-92516435 CCAGGTGAACTTTATAAATTAGG - Intergenic
994774676 5:104027042-104027064 CCAGGAGCCCCAGATAATTCTGG + Intergenic
997885126 5:137623048-137623070 GCAGCAGCCCTTGATAAAGCTGG + Intronic
1006003540 6:30985306-30985328 CCAGGGGCCCTTGATCACTATGG - Intronic
1008685229 6:53919042-53919064 CCAGGAGCACCTGATGAATCAGG - Intronic
1009626500 6:66143633-66143655 CCAGGAGCCCTGGGTAATTCTGG - Intergenic
1011155667 6:84328066-84328088 CTAGGAACTCTTGATATATTAGG - Intergenic
1012509915 6:99991359-99991381 CTAGAAGACTTTGATAAATTTGG + Intronic
1014732761 6:125053024-125053046 CCAAGAGCACATGATATATTGGG - Intronic
1016644912 6:146395960-146395982 CAAGGAGCTCTAGACAAATTAGG - Intronic
1018871471 6:167786835-167786857 TCAGGAGCTCTTAATAAATATGG - Intronic
1019042884 6:169120899-169120921 CCAGGAGCCCTAGGTAATTCTGG + Intergenic
1022742873 7:33139891-33139913 TCAGGAGCACTTGATACAGTTGG + Intronic
1023506435 7:40903908-40903930 CCAACAGCACTTGATATATTTGG + Intergenic
1028333720 7:89626033-89626055 CCAGGAGCCCTTGATAAATTTGG + Intergenic
1030735943 7:113048767-113048789 CCAGGAATCCTACATAAATTGGG + Intergenic
1033097972 7:138447508-138447530 CCAGGAGCCCTTGATACATTTGG - Intergenic
1040703061 8:50090694-50090716 TCAGCAGCCCTTGATATTTTTGG - Intronic
1041374037 8:57193837-57193859 CCAGGTGCCCTTGAGCAACTTGG + Intergenic
1042088176 8:65131454-65131476 CCAGGAGACCCTGATGAATTTGG - Intergenic
1043496682 8:80808877-80808899 TCAGTAGCCTTTGATGAATTTGG + Intronic
1044364048 8:91322663-91322685 GCAGCAGCCTATGATAAATTTGG + Intronic
1047217977 8:122894290-122894312 CCAGAAGCCCTTGGGAAACTGGG - Intronic
1050480419 9:6081941-6081963 CCAGGAGCCCTTGATAAATTTGG + Intergenic
1052302897 9:26973846-26973868 CCAGGAGCTCTTGATAAATTTGG - Intronic
1055504406 9:76933036-76933058 CCTGGAGCCCCTGATAAGCTTGG - Intergenic
1059267535 9:113049717-113049739 TCTGGAGTCCTTGATAAGTTTGG - Intronic
1060000776 9:119956883-119956905 CCAAGAGCCCTTGGAGAATTAGG + Intergenic
1060434734 9:123583672-123583694 CAAGTAGCCTTTGTTAAATTAGG - Intronic
1060929275 9:127478757-127478779 CCTGGTGCCCTTGATCAATACGG + Intronic
1186160967 X:6776622-6776644 CCTGGAGGGCTTGATAAAATAGG - Intergenic
1188348064 X:29093112-29093134 TCAGGTGACCTTGATATATTAGG + Intronic
1189034299 X:37479904-37479926 CCAGGAGCCCTTGATAAATTTGG + Intronic
1189648387 X:43159619-43159641 CTAGGAGCCCCTCTTAAATTAGG - Intergenic
1192682083 X:73262856-73262878 CCAGGAGCCCTTGATAAATTTGG - Intergenic
1194950979 X:100125450-100125472 CAAAGTGACCTTGATAAATTAGG - Intergenic
1197162097 X:123335389-123335411 CCAGAAGCCCTTAATTAATAGGG - Intronic
1200119386 X:153783239-153783261 CCAGGAGGTCTTGGTAAGTTGGG + Exonic
1201490063 Y:14530466-14530488 CCAGGAGACCTAGAGAAAATGGG - Intronic
1202016360 Y:20410852-20410874 CCAGAAGCCCAGGAGAAATTGGG + Intergenic