ID: 1050480422

View in Genome Browser
Species Human (GRCh38)
Location 9:6081948-6081970
Sequence CCCTTGATAAATTTGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 12, 1: 23, 2: 24, 3: 36, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050480414_1050480422 5 Left 1050480414 9:6081920-6081942 CCTCTTTTATTTTGAGTCCCACC No data
Right 1050480422 9:6081948-6081970 CCCTTGATAAATTTGGAGGTAGG 0: 12
1: 23
2: 24
3: 36
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050480422 Original CRISPR CCCTTGATAAATTTGGAGGT AGG Intergenic
901946822 1:12711039-12711061 CCCTTGATAAATTTAGAGGTGGG - Intergenic
903355510 1:22744275-22744297 CCCTTGAACAATGTGGGGGTAGG + Intronic
907144921 1:52223096-52223118 CCCCTGATAAATTTAATGGTGGG - Intronic
909113134 1:71504609-71504631 CTTTTAATAAATTTGAAGGTGGG + Intronic
911797361 1:102091602-102091624 CCCTTGATAAACTTAGAGGTGGG - Intergenic
913231800 1:116746072-116746094 CCATTGATAAATTTAGAGGTGGG + Intergenic
913428907 1:118767078-118767100 CACTTAATAAATTTGGACTTAGG + Intergenic
913509883 1:119551861-119551883 CCCTTCATAAATATGTTGGTAGG - Intergenic
915776452 1:158493047-158493069 CCCATGATAAATTTGAAGCCGGG - Intergenic
916813410 1:168326788-168326810 TCCTCAATAAAGTTGGAGGTGGG - Intergenic
917312071 1:173689028-173689050 CCCTTGATAAATTTGGAGGTGGG - Intergenic
917407173 1:174719519-174719541 CCCTTGAAAAAATTGGTTGTTGG + Intronic
917612415 1:176702004-176702026 ACTTTAATAGATTTGGAGGTGGG + Intronic
921768454 1:219003250-219003272 CCCTTGAACAATATGAAGGTTGG + Intergenic
923301929 1:232649369-232649391 CCTTTGATAGATTGGAAGGTTGG - Intergenic
924587634 1:245374165-245374187 ACCTTGATATATGTTGAGGTTGG - Intronic
924805187 1:247356253-247356275 CCCTTGATAAATTGGAAGGCGGG + Intergenic
1065058986 10:21877766-21877788 CCCTTGAACAATATGGAGGTTGG + Intronic
1067696731 10:48541275-48541297 CCCTAGATAAATTAGGATGTGGG - Intronic
1070992146 10:80741806-80741828 CCCATGATAAATTTGGAGGTGGG + Intergenic
1073262683 10:102202315-102202337 CTCTTGATAAATTTGAGGGTGGG - Intergenic
1073736694 10:106355603-106355625 CCTTTGACAAATTTGCATGTAGG - Intergenic
1075715466 10:124552707-124552729 ACCTTGGGGAATTTGGAGGTAGG - Intronic
1076115632 10:127896005-127896027 GCCTTAATAACTTTGGAGTTGGG - Intergenic
1076268892 10:129133298-129133320 CCCTTGAGAAATTTGAACCTGGG + Intergenic
1077702750 11:4456844-4456866 CCCTTGATAAATTTAGAGGAGGG + Intergenic
1078188580 11:9073260-9073282 CCCTTGATAAAGTAGCAGTTGGG - Intronic
1078605537 11:12771770-12771792 CCCTTGATAAATTGTGAGCCTGG - Intronic
1079015555 11:16865773-16865795 CCCTTGATAAATCTGGACTGTGG + Intronic
1079600301 11:22303951-22303973 TCCTGGATAATTTTGGGGGTGGG + Intergenic
1079657148 11:22998228-22998250 CCCTGGATAAATTTAGAAGTGGG - Intergenic
1080314902 11:30937337-30937359 CCCTTGATAAATTTGAAGGTGGG - Intronic
1081084428 11:38781590-38781612 CCATTCATGAATTTGGAGATGGG - Intergenic
1082745089 11:56952273-56952295 CCCTTAATACATTTGAAGATGGG + Intergenic
1084222532 11:67692781-67692803 CCCTTGATAAATTTAGAGGTGGG - Intergenic
1086140710 11:83495814-83495836 CCCTTAATAATTTTGGTGTTTGG - Intronic
1087079328 11:94154667-94154689 CCCTTGAACAATGTGGGGGTCGG + Intronic
1087126362 11:94630067-94630089 CCCTTGAAAAATGTGGGGTTTGG + Intergenic
1088107698 11:106224707-106224729 CCCTTGATAAATTTAGAGGTGGG + Intergenic
1090119779 11:124014127-124014149 CTCTGGATAATTTGGGAGGTGGG + Intergenic
1090323995 11:125869381-125869403 CCCTTGATAAATTTGGAGGTGGG - Intergenic
1092055090 12:5502216-5502238 CACTTGATCACTTTGGAAGTTGG + Intronic
1092331877 12:7592665-7592687 CCCTTGATAGATTTGAGGGTGGG + Intergenic
1092586762 12:9908560-9908582 CCCTTGATAAACTTAGAGGTGGG - Intronic
1092715869 12:11390069-11390091 CATATGAAAAATTTGGAGGTGGG + Intronic
1093383874 12:18526599-18526621 CCCTTGGTAAATTTCCAGCTAGG - Intronic
1095306524 12:40645119-40645141 TCCTTGTTGAATGTGGAGGTTGG - Intergenic
1099104199 12:78479649-78479671 CCCTTGATAAATTTAGAGTTGGG + Intergenic
1102605939 12:114067210-114067232 CCTTTGATAAATTTGGAGGTGGG + Intergenic
1103251447 12:119503397-119503419 CCTTTGATAAATTAGGAGCTTGG - Intronic
1103644172 12:122377667-122377689 TCCTTGTTAACTTTGAAGGTCGG + Exonic
1105225305 13:18426216-18426238 CCCTTGATAAGTCTAGAAGTGGG + Intergenic
1106203085 13:27560219-27560241 GCCTTGGTCATTTTGGAGGTGGG - Intronic
1108935676 13:55877723-55877745 CCCTTGATAAATTTGAAGGTGGG - Intergenic
1109798568 13:67346093-67346115 CCCTGGATAAATTTGAAGGTTGG - Intergenic
1109834174 13:67833411-67833433 CCCTTGATAAAATTGTTGTTTGG - Intergenic
1111586511 13:90290083-90290105 CCCTTGATAAATTTGAAGGTAGG + Intergenic
1112301925 13:98238902-98238924 CCCTTGAACAATGTGGGGGTTGG - Intronic
1113525065 13:110968157-110968179 CCCCTGATAAATTTGGAGGTGGG + Intergenic
1114009774 14:18354560-18354582 CCCTTGATAAGTCTAGAAGTGGG + Intergenic
1117471996 14:56055779-56055801 CCCTTGATAAATTTGCCAGTAGG - Intergenic
1117658391 14:57979855-57979877 CCATTGCTAAATGTGGAGTTGGG - Intronic
1118236612 14:64011009-64011031 TGCTTGATATACTTGGAGGTTGG + Intronic
1118752489 14:68816937-68816959 CCTTTGCTACATTTGAAGGTGGG + Intergenic
1119546605 14:75476567-75476589 CCCTTGACTAATTGAGAGGTGGG + Intergenic
1121291824 14:92782018-92782040 CACTTGATAAAGTTGGTGGTAGG - Intergenic
1122382408 14:101317811-101317833 CCCTTGTTAAATTTAGAAGTGGG + Intergenic
1124934775 15:34159995-34160017 CCCTTGATAAATTTACAAGTGGG - Intronic
1124943798 15:34244179-34244201 CCCTTGATTAAGTAGGAAGTAGG + Intronic
1126487355 15:49196396-49196418 CACTTAAGAAATTTGCAGGTAGG + Intronic
1129626004 15:77200420-77200442 CCCTTGAACAATGTAGAGGTTGG - Intronic
1129811901 15:78517955-78517977 CCCTTGAGAAATTAGCAGATGGG - Intronic
1130094662 15:80847032-80847054 CTTTTGATTATTTTGGAGGTGGG + Intronic
1130263638 15:82379402-82379424 CCCTTGATAAATTTACAAGTGGG - Intergenic
1130435560 15:83895792-83895814 AAATTGATAAATTTGGGGGTAGG + Intronic
1130981960 15:88818709-88818731 CCCTTGAAAATCTTGGAGGAAGG - Intronic
1131234138 15:90681744-90681766 CCATTGAGGAATGTGGAGGTTGG + Intergenic
1139322132 16:66123313-66123335 CCCTTGAACAACTTGGCGGTTGG + Intergenic
1140119004 16:72067213-72067235 CCCTTGATAAATTTGGAGGTGGG + Intronic
1140683212 16:77405895-77405917 ACCCTGATATATTTGGAAGTAGG - Intronic
1141740107 16:85885407-85885429 CTCGTGATAAACTTGGAGATCGG - Intergenic
1144672751 17:17142220-17142242 TCCTTGCTAAATTTTGGGGTGGG + Intronic
1146889108 17:36493469-36493491 CCTTTGAGAAATTTCCAGGTTGG + Intronic
1148361936 17:47018931-47018953 CCCTTGATATATTCGAAGTTGGG - Intronic
1149256322 17:54831507-54831529 CCCTTGAAAAATTAAGAGGCTGG + Intergenic
1149739006 17:59025538-59025560 CCCTTGGTATATGTGGGGGTTGG + Intronic
1151923032 17:77172204-77172226 CCCTTGATAAATTTAGAGGTGGG - Intronic
1154332944 18:13444571-13444593 CCTTTGAACAATTTGGGGGTTGG - Intronic
1154528067 18:15313306-15313328 CCCTTGATAAGTCTAGAAGTGGG - Intergenic
1155076805 18:22364610-22364632 CCCTTGAATAATGTGGGGGTTGG - Intergenic
1156300862 18:35834721-35834743 CCCTTGATAAATTTAGAGGTGGG + Intergenic
1156339340 18:36197151-36197173 CCCTTCACATATTTGGAGGCCGG + Intronic
1157225078 18:45855389-45855411 GCCTACAAAAATTTGGAGGTTGG + Intronic
1157349453 18:46871590-46871612 CCCTTGATAAACTTAGAGGTGGG + Intronic
1158532358 18:58275013-58275035 CCCTTGAACAAAGTGGAGGTTGG + Intronic
1159300039 18:66551963-66551985 CCCTTGATATATTTGGGTATTGG - Intronic
1162268295 19:9594186-9594208 CCCTTGATCAATTTGGATGTGGG - Intergenic
1162272660 19:9629068-9629090 CCCTTGATAAATCTACAGGTGGG + Intronic
1166497491 19:43314740-43314762 CCCTTGATAAATTTAAAGGTAGG - Intergenic
1167904806 19:52650209-52650231 CCCGTGGTAAATTTAAAGGTGGG + Intronic
926935970 2:18086819-18086841 CCCTTGATAAACCTGAGGGTGGG - Intronic
929845663 2:45522965-45522987 CCCTTGAACAATGTGGAGGTTGG - Intronic
930345161 2:50170813-50170835 CCCTTGAACAATGTGGGGGTTGG + Intronic
932636305 2:73391230-73391252 CTGTAGATAAATTTGGAGATGGG - Intronic
933189473 2:79317735-79317757 GCCTTGATAAATTTGCAGATGGG - Intronic
933374586 2:81463178-81463200 GCCATGTTGAATTTGGAGGTAGG + Intergenic
933389910 2:81655799-81655821 CCCTTGATAAATTTGGAGGTGGG - Intergenic
934141060 2:89047946-89047968 CCCCTGAACAATGTGGAGGTTGG + Intergenic
934220819 2:90080979-90081001 CCCCTGAACAATGTGGAGGTTGG - Intergenic
934228174 2:90152596-90152618 CCCCTGAACAATGTGGAGGTTGG - Intergenic
935048097 2:99499570-99499592 CCCTTGATAAATTTGGAGGTGGG + Intergenic
936454786 2:112664504-112664526 CCCTTGAACAGTGTGGAGGTTGG + Intergenic
939323754 2:140659631-140659653 CCTATGTTAAATTTGTAGGTGGG - Intronic
940352363 2:152704038-152704060 CCCTTGATAAATCTAGAAGCGGG + Intronic
943197049 2:184766832-184766854 CCCATGCAAAATTTGGAGGTTGG + Intronic
943953736 2:194160704-194160726 TCTTTGATAAATTTGAAGGTGGG - Intergenic
944616684 2:201467416-201467438 CCATTGATATATTTGGAGGTTGG - Intronic
946650515 2:221888299-221888321 GCCTTGATAACTTTGAAGGGAGG + Intergenic
946863661 2:224023654-224023676 CCTTTGATATATTTGGAGGGAGG - Intronic
947617397 2:231567196-231567218 CAATATATAAATTTGGAGGTGGG - Intergenic
948168794 2:235884081-235884103 CCCTTGATAAAATTTAAAGTTGG + Intronic
1168823739 20:794594-794616 CCCTTGATAAATTTGGGGGTGGG + Intergenic
1171138606 20:22721172-22721194 CCCTTGATTAAATTTAAGGTAGG + Intergenic
1171418169 20:24997781-24997803 CCCTTGAACAAAGTGGAGGTTGG - Intergenic
1173277468 20:41597242-41597264 CCCCTTATAAATTTAGAGGTGGG + Intronic
1173298172 20:41777869-41777891 CCTTTGCTGAATTTGGAGTTGGG + Intergenic
1174259722 20:49285176-49285198 CCCCTGATAAATTTAGAGGTGGG - Intergenic
1175100782 20:56577337-56577359 CAACTGATAAATTTGGAGGTTGG - Intergenic
1176769360 21:13055235-13055257 CCCTTGATAAGTCTAGAAGTGGG + Intergenic
1176849699 21:13903445-13903467 CCCTGGAAACATTGGGAGGTGGG - Intergenic
1177206888 21:18020715-18020737 CCCTAGCTATATTTGGAGATGGG + Intronic
1177265078 21:18772551-18772573 CACTTGATTAATTTGAAAGTGGG + Intergenic
1177635707 21:23784341-23784363 CCCTTGAACAATATGGGGGTGGG - Intergenic
1178469414 21:32878716-32878738 TCCTTGAGGAATTTGGAGCTAGG + Intergenic
1178580357 21:33832808-33832830 CTCTTGATAAACTGGCAGGTGGG + Intronic
1178809779 21:35871056-35871078 CTTTTGAGAAATTTGCAGGTTGG + Intronic
1180434274 22:15285369-15285391 CCCTTGATAAGTCTAGAAGTGGG + Intergenic
1180516460 22:16149179-16149201 CCCTTGATAAGTCTAGAAGTGGG + Intergenic
1181430151 22:22875691-22875713 GCCTTGCTAAATTTGGATGCAGG - Intronic
1183922078 22:41177539-41177561 CCTTTGAAAAATTTGCACGTGGG - Exonic
1184064825 22:42112412-42112434 CCCTTGATAAATTTACAGGTGGG - Intergenic
949555232 3:5146916-5146938 CCCTTGATAAATTTGAAGGTGGG - Intronic
949598492 3:5573409-5573431 GCTTTCATAAATATGGAGGTAGG - Intergenic
950228173 3:11253240-11253262 CCCTTGGTAAATTTAGAAGTGGG - Intronic
950594934 3:13971601-13971623 CCCTTAATAAATTTAGAAGTGGG - Intronic
950602189 3:14044770-14044792 CCCTTGATAAATATAGAGGTGGG - Intronic
950656901 3:14442188-14442210 CTCTTGAAAAATTGGAAGGTTGG - Intronic
950846579 3:16021473-16021495 CCCTTGATAAATTTGGAGGTGGG - Intergenic
951651259 3:24954270-24954292 CACATGATGAATTTTGAGGTGGG - Intergenic
953226734 3:41028264-41028286 CCTTTGATGAATGTGAAGGTAGG + Intergenic
953965442 3:47301634-47301656 CCCTTGAACAATGTGGGGGTTGG + Intronic
954006271 3:47593639-47593661 ATCTTGAAAAATTTGGAGATTGG + Intronic
954581110 3:51703396-51703418 CCCTTAATAAATGTGGGGGGAGG + Intronic
957989726 3:87613253-87613275 CCCTTGATAAATTCAGAGATGGG - Intergenic
959935148 3:112021510-112021532 CCTGTGTTAAAGTTGGAGGTGGG + Intergenic
960119462 3:113932514-113932536 ACTTTGATTAATTTTGAGGTGGG + Intronic
960707099 3:120492036-120492058 CCCTTGATAAATTTTACAGTGGG + Intergenic
961582424 3:127893453-127893475 CCCTTGATACATTTAGAGGTGGG + Intergenic
961595467 3:128012499-128012521 CACAGGATAAATTAGGAGGTCGG + Intergenic
961965621 3:130899193-130899215 CCCTTGAACAATGTGGGGGTTGG + Intronic
964792038 3:160461368-160461390 CTCTTGAACAATGTGGAGGTTGG - Intronic
965141775 3:164846543-164846565 CACTTGATTAAATTGGAGGGAGG + Intergenic
965322865 3:167269160-167269182 CCCTTGATACATTTAGAAGTGGG + Intronic
966487950 3:180492051-180492073 ATCTTGATAAATCTGGAGGGAGG - Intergenic
971866710 4:32181712-32181734 GCCATGATAAACTTGGACGTTGG - Intergenic
973529073 4:51817636-51817658 CCCTTAATAAATTTGGAAGTGGG - Intergenic
975135809 4:70873335-70873357 CCCTTGATATAAGTGGTGGTCGG + Intergenic
975273768 4:72470023-72470045 TCCTTGATCAATGCGGAGGTTGG - Intronic
975289523 4:72660666-72660688 CCCATGCTATATTTGGAGTTGGG - Intergenic
975789836 4:77937305-77937327 CCCTTGACTAATTTGGAGCCAGG + Intronic
977609692 4:99019280-99019302 CCCTTGATAAATTTGGAGGTGGG - Intronic
978001557 4:103560138-103560160 CTCTTGAACAATGTGGAGGTTGG + Intergenic
978310762 4:107382712-107382734 CCCTTGATAAATTTGGAGGTGGG + Intergenic
980582420 4:134772211-134772233 CCATTGATATCTTTGGAGGAAGG + Intergenic
981218077 4:142195540-142195562 AACTTGATGAATTTGGACGTAGG - Intronic
981688689 4:147482028-147482050 CCCCTGATAGAGTTGGGGGTGGG + Intronic
982590454 4:157302584-157302606 CTCATGATAACTTTTGAGGTAGG - Intronic
982598150 4:157412121-157412143 CCTTTGATAAAAATGGAGCTGGG + Intergenic
983336506 4:166400380-166400402 CTCTGGATAAATATGGAGTTGGG - Intergenic
984059308 4:174972784-174972806 CCCTGGAGAAATTTGGGTGTTGG + Intronic
984735292 4:183102506-183102528 CCCTTGTTAAGTGTGGAGCTAGG + Intronic
987394888 5:17413587-17413609 CAGTTGAGAAACTTGGAGGTGGG - Intergenic
987735995 5:21844304-21844326 CTCATGTTAAATTTGGAGTTTGG + Intronic
988625824 5:32873239-32873261 CAATGTATAAATTTGGAGGTTGG + Intergenic
988684200 5:33512190-33512212 GCCTTGATAAATATGGAGGAGGG + Intergenic
989615490 5:43333762-43333784 CCCTTGATAAATTTGGAGGTGGG - Intergenic
990369954 5:55107690-55107712 CCATTTGTAAATATGGAGGTGGG - Intronic
991052244 5:62285671-62285693 TTCTTGAGAAATTTGGAGGGTGG + Intergenic
991215771 5:64156174-64156196 CTCTTGATAAATTTAGAGGTGGG + Intergenic
992232401 5:74676455-74676477 CCCTTTAAAAATTTGCATGTGGG - Intronic
995634106 5:114165895-114165917 CCCTTGAAAAATGTGGGGTTAGG - Intergenic
996654101 5:125917021-125917043 CCCTTGATAAAATTGATGGTGGG + Intergenic
997064755 5:130547595-130547617 CCCTTGATAAATTTGAAGGTGGG - Intergenic
997530974 5:134581048-134581070 ACCTTGATAGTTTTGGAGTTAGG - Exonic
999554079 5:152721671-152721693 CTTTTGATAAATTTAGAGGTGGG + Intergenic
1001267729 5:170287034-170287056 TTCTTGATAAATTTGAAGATAGG + Intronic
1001661746 5:173398436-173398458 CACTTCATAAAGTTGGAGCTGGG - Intergenic
1004733874 6:18385720-18385742 CCATTGCTAAATCTGAAGGTTGG + Intergenic
1005574808 6:27180939-27180961 CCCTTGATAAATTTAACGGTGGG + Intergenic
1006049967 6:31334710-31334732 CCCTTGATAAATTTAGAGGTGGG - Intronic
1007332133 6:41120447-41120469 CCCTTCATGAATTTCGAGGTTGG + Intergenic
1009941680 6:70296689-70296711 ACCTCAATAAATTTGGAGCTGGG + Intronic
1016042868 6:139450288-139450310 TTCTTGATAAAATTGGAGATGGG + Intergenic
1016978147 6:149829203-149829225 CCAATAATAAATTTGGAAGTGGG + Intronic
1018557391 6:165063466-165063488 CCCTTGATAAATTGGAGGGTGGG - Intergenic
1018570790 6:165207578-165207600 CCCTTGAACAATGTGGAGTTAGG + Intergenic
1020745014 7:12069489-12069511 CCCTTAATAAATTTAGAAGTGGG + Intergenic
1020851305 7:13356967-13356989 CCCTGGACAATTTTAGAGGTAGG + Intergenic
1021197041 7:17685443-17685465 CCATATATAAATTTGGGGGTGGG + Intergenic
1021517771 7:21506293-21506315 CCCTTAATAAATTTGAAGGTGGG - Intronic
1023180544 7:37478181-37478203 ACCTTGATAAGTTTGAAGATAGG - Intergenic
1025015098 7:55433082-55433104 CCCTTGAGAAATGGGGAGGCAGG - Exonic
1025190048 7:56889445-56889467 CCCTTTTTAAATTTGGAGACAGG - Intergenic
1027642634 7:80756274-80756296 CTATTGATATATTTGGATGTGGG - Intronic
1028018491 7:85743421-85743443 CCCTTGATAAATTTAGACGTGGG - Intergenic
1028079619 7:86558669-86558691 CTCTTGGTAAATTTTGAAGTGGG - Intergenic
1028333724 7:89626040-89626062 CCCTTGATAAATTTGGAGGTGGG + Intergenic
1031417205 7:121508667-121508689 CCCTTCATAAATTCAGAAGTGGG - Intergenic
1031839747 7:126723592-126723614 CCCTTGATATCTTTGGCAGTGGG - Intronic
1033097968 7:138447501-138447523 CCCTTGATACATTTGGAGGTGGG - Intergenic
1033894724 7:146056063-146056085 CCCTTGATAAACTTGAGGGTGGG - Intergenic
1035731782 8:1858616-1858638 CGCTTTCTAAGTTTGGAGGTGGG + Intronic
1036093219 8:5692318-5692340 CCCTTGAAAAGTTTAGAGTTAGG - Intergenic
1036104846 8:5828334-5828356 CCCTTGATAAATTTAGAAGTGGG - Intergenic
1036394747 8:8360095-8360117 CCCTTGATAAATTTAGAGGTGGG - Intronic
1039689621 8:39850134-39850156 CCCTTGATAAATTTAGATGTTGG - Intergenic
1040621557 8:49097651-49097673 CCCTTGATATATTTAGAGGTGGG + Intergenic
1040983751 8:53271206-53271228 CCCTTGATAAATTTAGAGGTAGG - Intergenic
1042088173 8:65131447-65131469 ACCCTGATGAATTTGGAGGTGGG - Intergenic
1043331329 8:79121546-79121568 CCCTTGATAAATTTAGAGGTGGG + Intergenic
1043709299 8:83395016-83395038 ACCTTGATTAATTTGGGGATAGG - Intergenic
1044312507 8:90710204-90710226 ACCTTGACAGAATTGGAGGTTGG - Intronic
1044865108 8:96563271-96563293 CTCTTGAAAATTTTGGAGGCAGG - Intronic
1045057933 8:98385211-98385233 CCCTAGATAGATTTGGAGGGTGG + Intergenic
1046448343 8:114355528-114355550 CCCTTGATCAATATGGTGCTTGG - Intergenic
1046664854 8:116989779-116989801 CCCATGATACATTTCCAGGTGGG - Intronic
1048156523 8:131960422-131960444 CCCTTGATATACTTGGGGATAGG - Intronic
1050480422 9:6081948-6081970 CCCTTGATAAATTTGGAGGTAGG + Intergenic
1050959512 9:11709414-11709436 CACTTGATAAATTAGGAGGAAGG + Intergenic
1052302894 9:26973839-26973861 CTCTTGATAAATTTGGAGGTGGG - Intronic
1052549432 9:29929179-29929201 CCCTGGCCAAATTTTGAGGTAGG + Intergenic
1052968048 9:34356636-34356658 CACTTGAAAAACTTGGGGGTTGG + Intergenic
1053705857 9:40752100-40752122 CCCTTGATAAGTCTAGAAGTGGG - Intergenic
1053720476 9:40941223-40941245 CTCTGGGTAAATTCGGAGGTTGG - Intergenic
1054345507 9:63910913-63910935 CTCTGGGTAAATTCGGAGGTTGG + Intergenic
1054415934 9:64875704-64875726 CCCTTGATAAGTCTAGAAGTGGG - Intergenic
1054859079 9:69931192-69931214 CCCTTGATAAATTTAGAGGTGGG - Intergenic
1056414811 9:86366114-86366136 CCCTTGATAAATTTGTAGGTGGG - Intergenic
1057997028 9:99828286-99828308 CCCTTGATCAAAGTGGAGGAGGG + Exonic
1060019691 9:120118280-120118302 CTCATGTTGAATTTGGAGGTGGG + Intergenic
1061141185 9:128767949-128767971 ACCTTGATAAATATTGAGGCTGG - Intronic
1186258947 X:7755341-7755363 CCCCTAATAATGTTGGAGGTGGG + Intergenic
1187014593 X:15313435-15313457 ATCTTGGTAAATTTGGGGGTGGG + Intronic
1189034303 X:37479911-37479933 CCCTTGATAAATTTGGAGGTGGG + Intronic
1189282812 X:39831080-39831102 CCCTTTAAAAATTTGGAAGCTGG - Intergenic
1190823921 X:53999490-53999512 CCCTTGAACAATGTGGAGGTTGG - Intronic
1192277892 X:69651910-69651932 CACCTGATGAATTTGGTGGTGGG + Intronic
1192682080 X:73262849-73262871 CCCTTGATAAATTTGGATGTGGG - Intergenic
1193024347 X:76829043-76829065 CCTTTGATAAAATTTGAGTTGGG + Intergenic
1193995906 X:88365799-88365821 CCCAAGATAAATTGGGATGTAGG + Intergenic
1194552691 X:95320975-95320997 CCCATGATAATTTTGGGGATTGG - Intergenic
1195427786 X:104754492-104754514 CCATTTATAAAATTGGAGATAGG + Intronic
1196724944 X:118887358-118887380 CCGCTGATAAATGTGAAGGTGGG + Intergenic
1196988580 X:121302297-121302319 CCCTTTACAAATTTGGACCTTGG + Intergenic
1199016694 X:142825261-142825283 ACCTTGAAAAGTTTGGAGATTGG - Intergenic
1199389104 X:147259303-147259325 CCATTAATAGATTTGGATGTTGG + Intergenic
1199389178 X:147260188-147260210 CCGTTAATAGATTTGGATGTTGG + Intergenic
1200301707 X:154983054-154983076 CCCTTGAACAATGTGGGGGTTGG - Intronic
1200777492 Y:7182566-7182588 CCCTTGATAAATTTAAAGGTGGG - Intergenic
1201972713 Y:19814795-19814817 CCCTTGATAAATTTGAAAGTGGG - Intergenic
1202088315 Y:21162440-21162462 CCCTTGATAAATCTAGAGGTGGG - Intergenic
1202201482 Y:22355553-22355575 GGCTTGATAAATTTGGAGACAGG - Intronic