ID: 1050483638

View in Genome Browser
Species Human (GRCh38)
Location 9:6111900-6111922
Sequence CTGAATATACAAATAAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050483636_1050483638 4 Left 1050483636 9:6111873-6111895 CCATACTATGTTGTTTATCTTGA No data
Right 1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG No data
1050483634_1050483638 21 Left 1050483634 9:6111856-6111878 CCACATAGCATTTACCACCATAC No data
Right 1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG No data
1050483635_1050483638 7 Left 1050483635 9:6111870-6111892 CCACCATACTATGTTGTTTATCT No data
Right 1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG No data
1050483633_1050483638 22 Left 1050483633 9:6111855-6111877 CCCACATAGCATTTACCACCATA No data
Right 1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050483638 Original CRISPR CTGAATATACAAATAAACAC TGG Intergenic
No off target data available for this crispr