ID: 1050485487

View in Genome Browser
Species Human (GRCh38)
Location 9:6129977-6129999
Sequence TTGTTTAAGTACATTTATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050485487_1050485488 27 Left 1050485487 9:6129977-6129999 CCTAAATAAATGTACTTAAACAA No data
Right 1050485488 9:6130027-6130049 CACTATTCACAGTAGCCAAAAGG 0: 9
1: 191
2: 781
3: 1503
4: 1873

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050485487 Original CRISPR TTGTTTAAGTACATTTATTT AGG (reversed) Intergenic
No off target data available for this crispr