ID: 1050485487 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:6129977-6129999 |
| Sequence | TTGTTTAAGTACATTTATTT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1050485487_1050485488 | 27 | Left | 1050485487 | 9:6129977-6129999 | CCTAAATAAATGTACTTAAACAA | No data | ||
| Right | 1050485488 | 9:6130027-6130049 | CACTATTCACAGTAGCCAAAAGG | 0: 9 1: 191 2: 781 3: 1503 4: 1873 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1050485487 | Original CRISPR | TTGTTTAAGTACATTTATTT AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||