ID: 1050486872

View in Genome Browser
Species Human (GRCh38)
Location 9:6143653-6143675
Sequence ATAGGCCAGCGGTCTCCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050486868_1050486872 -3 Left 1050486868 9:6143633-6143655 CCAAGCTGCAGGTTGGTCCAATA No data
Right 1050486872 9:6143653-6143675 ATAGGCCAGCGGTCTCCAATAGG No data
1050486865_1050486872 14 Left 1050486865 9:6143616-6143638 CCTTGCTGGGCTTGATTCCAAGC No data
Right 1050486872 9:6143653-6143675 ATAGGCCAGCGGTCTCCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050486872 Original CRISPR ATAGGCCAGCGGTCTCCAAT AGG Intergenic
No off target data available for this crispr