ID: 1050487211

View in Genome Browser
Species Human (GRCh38)
Location 9:6146955-6146977
Sequence GAGGCAAGGTGTTGGGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050487200_1050487211 25 Left 1050487200 9:6146907-6146929 CCCCTAGAAATTTCCTCAAGGAA No data
Right 1050487211 9:6146955-6146977 GAGGCAAGGTGTTGGGGAAGGGG No data
1050487201_1050487211 24 Left 1050487201 9:6146908-6146930 CCCTAGAAATTTCCTCAAGGAAA No data
Right 1050487211 9:6146955-6146977 GAGGCAAGGTGTTGGGGAAGGGG No data
1050487202_1050487211 23 Left 1050487202 9:6146909-6146931 CCTAGAAATTTCCTCAAGGAAAC No data
Right 1050487211 9:6146955-6146977 GAGGCAAGGTGTTGGGGAAGGGG No data
1050487203_1050487211 12 Left 1050487203 9:6146920-6146942 CCTCAAGGAAACACTTGAGTTCA No data
Right 1050487211 9:6146955-6146977 GAGGCAAGGTGTTGGGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050487211 Original CRISPR GAGGCAAGGTGTTGGGGAAG GGG Intergenic
No off target data available for this crispr