ID: 1050494115

View in Genome Browser
Species Human (GRCh38)
Location 9:6221700-6221722
Sequence AGAGGTTACTAGTTGCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050494115_1050494118 20 Left 1050494115 9:6221700-6221722 CCATGCAGCAACTAGTAACCTCT 0: 1
1: 0
2: 1
3: 13
4: 133
Right 1050494118 9:6221743-6221765 ATATTTTATGAAAAGTGTCTTGG No data
1050494115_1050494119 26 Left 1050494115 9:6221700-6221722 CCATGCAGCAACTAGTAACCTCT 0: 1
1: 0
2: 1
3: 13
4: 133
Right 1050494119 9:6221749-6221771 TATGAAAAGTGTCTTGGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050494115 Original CRISPR AGAGGTTACTAGTTGCTGCA TGG (reversed) Intronic
905183614 1:36180743-36180765 ACAGGATACTGGTTGCTTCAGGG + Exonic
907174124 1:52501925-52501947 GGTGGTTACTAGGGGCTGCAGGG + Intronic
911957030 1:104250310-104250332 AGAGGCATCTACTTGCTGCATGG + Intergenic
912781830 1:112557268-112557290 ATAGGTTAGTAGTTGCTTAAGGG - Intronic
914355726 1:146882615-146882637 AGAGGTTAGTAGCTGCTGCCCGG + Intergenic
914860431 1:151381539-151381561 AGTGGGTTCTGGTTGCTGCAGGG + Intergenic
916984598 1:170177248-170177270 AGAGGTGAGTAGTTGCCACAAGG + Intergenic
918463400 1:184798051-184798073 AAAGGTTACCTGGTGCTGCAGGG - Intronic
919196995 1:194298802-194298824 AGAGGCAACTATTTGCTTCAGGG - Intergenic
921650037 1:217666726-217666748 AGTGGTTACTAGTGACTGGAGGG - Intronic
922403235 1:225282748-225282770 AGAGTTTGATAGTTACTGCAGGG + Intronic
1063641336 10:7833695-7833717 AGCCTTTGCTAGTTGCTGCATGG - Intronic
1063710262 10:8470357-8470379 AGAGGTTTCAGGTTGTTGCAGGG - Intergenic
1064330006 10:14384767-14384789 AGAGGTTACCAGGGGCTGCAGGG + Intronic
1069397142 10:68001730-68001752 AGTGGTTACTAGTTCCTAGAGGG - Intronic
1069949684 10:72010267-72010289 AGAGCTTACAAGGAGCTGCAAGG + Exonic
1070868189 10:79723130-79723152 AGAGGTTACCAGGGGCTGGAAGG + Intergenic
1071635099 10:87245331-87245353 AGAGGTTACCAGGGGCTGGAAGG + Intergenic
1071660143 10:87492661-87492683 AGAGGTTACCAGAGGCTGGAAGG - Intergenic
1072171509 10:92867356-92867378 TGTGGTTTCTAGTTACTGCATGG - Intronic
1072638766 10:97195388-97195410 AGAGGTTGCTAGGGGCTGGAGGG + Intronic
1073058685 10:100719389-100719411 AGAGGTTACTAGAAGCCGAAAGG - Intergenic
1075293766 10:121254166-121254188 TGAGGTCACCAGTTGCTGGAAGG - Intergenic
1075589895 10:123683901-123683923 AGAGGATACAAAGTGCTGCAGGG - Intronic
1081249975 11:40817493-40817515 AGAACTTAGTAGTTGATGCAAGG + Intronic
1082726514 11:56743379-56743401 ATGGGTTACAAATTGCTGCATGG + Exonic
1085161470 11:74350988-74351010 AGAGGTTTCTTGTGGCTGGAAGG - Intronic
1088523736 11:110728709-110728731 AGAGGAAACTGCTTGCTGCAAGG - Intergenic
1089451669 11:118602384-118602406 GGTGGTTAAAAGTTGCTGCAAGG + Exonic
1091416656 12:293283-293305 AGAGGTTACCAGAGGCTGAAGGG + Intronic
1092467111 12:8742910-8742932 AGAGCTCCCTTGTTGCTGCATGG - Intronic
1094253418 12:28393641-28393663 TTAGTTTACTACTTGCTGCAAGG + Intronic
1100415026 12:94363009-94363031 AGTGGTTACTAGAGGCTGGAAGG + Intronic
1103986576 12:124771590-124771612 AGAGGTTATGAATTGCTCCAAGG + Intergenic
1108164822 13:47681486-47681508 AGTGTTTGGTAGTTGCTGCAAGG - Intergenic
1109053726 13:57518627-57518649 AAATGTTATTAGTTGCTCCATGG - Intergenic
1111140209 13:84107567-84107589 AGAGGATACTTGATACTGCATGG + Intergenic
1111841063 13:93451606-93451628 AGAGTTGAGTAGTTGCAGCAGGG + Intronic
1113035338 13:106041527-106041549 AGAGATGACTAAATGCTGCATGG - Intergenic
1114767919 14:25395436-25395458 TGAGGTTTCCTGTTGCTGCAAGG + Intergenic
1117043487 14:51789261-51789283 AGAGGTTACTAGAGGCTGGGAGG - Intergenic
1121079311 14:91095012-91095034 AGAGGTGACCAGCTGCTGGAGGG - Intronic
1123800776 15:23818093-23818115 AGTGGTTACTAGTGGCTGGAGGG - Intergenic
1131989230 15:98077195-98077217 GGAGGGTGGTAGTTGCTGCATGG - Intergenic
1137475010 16:48800108-48800130 AGAGGTTAATAGTGAATGCAGGG + Intergenic
1139978291 16:70832829-70832851 AGAGGTTAGTAGCTGCTGCCCGG - Exonic
1142883602 17:2898978-2899000 AGAGGTTGCCAGGGGCTGCAGGG - Intronic
1146972324 17:37083114-37083136 AGAGGCTACCAGCTGCGGCAGGG - Intergenic
1149650616 17:58273888-58273910 AGAGGTTAATAATTGGTCCAAGG - Intronic
1153543380 18:6181075-6181097 AGAGGTTAATAGGGTCTGCAGGG + Intronic
1153570281 18:6465114-6465136 AGAGGTTACTAGGGGCTGTTTGG - Intergenic
1154555852 18:15752721-15752743 AGAGTTTACAAGTTGATACATGG + Intergenic
1156046973 18:32888160-32888182 AGAGTTTTCTAAATGCTGCAAGG + Intergenic
1156457442 18:37302671-37302693 AGAGTTTCCTGGGTGCTGCAGGG + Intronic
1157201115 18:45660671-45660693 AGAAGTCACTAATTTCTGCATGG - Intronic
1157489809 18:48115086-48115108 AGAGGTTACCAGGGGCTGGATGG - Intronic
1157668506 18:49508782-49508804 AGAGGATACTAGAAGCTGGAAGG + Intergenic
1158357918 18:56640754-56640776 AGAGGTTAGTAGTTTGTGCATGG - Intronic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
927122681 2:19982493-19982515 AAAGGTTACTGGGGGCTGCAAGG + Exonic
928236996 2:29552026-29552048 AGAGGTTACCAGGTGCTGAGGGG - Intronic
930512675 2:52365653-52365675 AGTGGTTACTAGGGGCTGGAAGG - Intergenic
930764218 2:55068300-55068322 TGATGTTACTAGATGATGCATGG - Intronic
932066074 2:68562211-68562233 AGTGGTTACTAGAGGCTGGAAGG + Intronic
932481186 2:72040351-72040373 AGAGGTCTGTAGGTGCTGCATGG - Intergenic
935621447 2:105133862-105133884 AGAGGTTACCAGCAGCTGCAGGG + Intergenic
935716729 2:105945859-105945881 GGAGGTTGCCAGTGGCTGCAGGG + Intergenic
937424184 2:121784460-121784482 AGGGGTTACTAGTTGCTACTGGG + Intergenic
939474666 2:142672327-142672349 AGAGGATACTAGAGGCTGGAAGG - Intergenic
942062838 2:172243706-172243728 AGAAGTTACCAGTTGGAGCAGGG + Intergenic
945205663 2:207329297-207329319 AGAGTTTACGAGATGCTGGATGG + Intergenic
946540015 2:220674016-220674038 AGAGGCTACTAGCTGCTGCAAGG - Intergenic
946579952 2:221117586-221117608 AGAGTTTTCTATCTGCTGCAAGG - Intergenic
946613850 2:221488070-221488092 AGAGTTGAGTAGTTGCTGCAGGG - Intronic
1168867146 20:1096645-1096667 AGAGGTTGCTATTTGGGGCAGGG - Intergenic
1169200950 20:3709885-3709907 AGAGGTAACCAGGGGCTGCAGGG + Intergenic
1177223546 21:18223961-18223983 AGAGAATACTAGTTGCTGGAGGG + Intronic
1182402403 22:30089890-30089912 AGAGGTTACCAGGTGCTGGTGGG - Intronic
949153918 3:806095-806117 AGAGATTAATAGTTGTAGCAGGG - Intergenic
952041088 3:29262635-29262657 GGATGTTACTAGGTTCTGCAGGG + Intergenic
952459561 3:33510191-33510213 AGAGGTTACCAGGTGCTGGGGGG + Intronic
953821976 3:46214741-46214763 AGAGGGTAATGGATGCTGCAGGG + Intronic
955670821 3:61400669-61400691 AGAGGTTACCAGAGGCTGGAAGG - Intergenic
956288037 3:67631289-67631311 AGAGGTGAATGGTTGCAGCAGGG + Intronic
956666432 3:71646226-71646248 AGAGGTTACCAGGGTCTGCAGGG - Intergenic
957926812 3:86824667-86824689 AGTTGTTTCTAATTGCTGCATGG - Intergenic
962070044 3:132023950-132023972 AGATGTTACTATTTGCAGCATGG + Intronic
963090143 3:141476431-141476453 AGAGGTTTCCAGTTGCCTCAGGG + Intergenic
964707176 3:159631649-159631671 AGAGGTTACCAGGGGCTGGAGGG + Intronic
964971322 3:162566629-162566651 AGTGGTTACTATTTTCTCCAGGG - Intergenic
969201762 4:5612494-5612516 AGAGGTTGCTCCCTGCTGCAAGG + Intronic
972804446 4:42513794-42513816 AAAGGTCACTAGTAGCTGTATGG + Intronic
972843334 4:42956899-42956921 AGGGGTTTCTCGTTGCTGTAGGG + Intronic
975641693 4:76506719-76506741 AGAGTTGAGTAGTTGCTGCAGGG - Intronic
980114314 4:128664502-128664524 AGAGGTGACTGGTTTCTGGAAGG - Intergenic
983234911 4:165168253-165168275 AGAGGTTACCAGGGGCTACAGGG - Intronic
984065736 4:175045185-175045207 AGAAGTTACTTATTGCTACAGGG - Intergenic
988202121 5:28082727-28082749 AGAGGTCACCAGCTGCAGCAGGG + Intergenic
991392135 5:66156863-66156885 AGAGGTTACTAGCTTCTAAATGG + Intronic
994910047 5:105892752-105892774 AGATGTTAATAGTTGGAGCAGGG + Intergenic
995358260 5:111264291-111264313 AGTGGTTACCAGTCGCTCCAGGG + Intronic
995605429 5:113849378-113849400 AGAGATTACTAGGGGTTGCAGGG - Intergenic
996556811 5:124786699-124786721 AGAGGTTACTAGAGGCTGAGGGG + Intergenic
996915082 5:128702796-128702818 AAAGGGTTCTAGGTGCTGCATGG + Intronic
1002448515 5:179305498-179305520 AGTGTTTACTGGTTGCTCCAGGG - Intronic
1003371739 6:5534448-5534470 AGAGGTTACTAGGCACTGGAGGG - Intronic
1004401033 6:15288888-15288910 AGAGCTTACTAGCTGCTTTAAGG - Intronic
1004739353 6:18442712-18442734 AGAGGTTACTAGGGGTTTCAGGG - Intronic
1008860073 6:56138491-56138513 AAAGGTAACTAGTGGCAGCAAGG + Intronic
1009801658 6:68545591-68545613 GGAAGTTAATAGTTTCTGCAGGG + Intergenic
1009826463 6:68871627-68871649 AGAGCTTCCTAGTTGGTGCAGGG - Intronic
1016355764 6:143216576-143216598 AGACTTTACTTGTTGCTGCTAGG + Intronic
1017269515 6:152490537-152490559 AGGGGTTACAAGGTGCTGAATGG - Intronic
1018606222 6:165600593-165600615 AAAGGTGACTAGATGCTGCTGGG - Intronic
1020570308 7:9851703-9851725 AGAGGTGCCTAGTTACTGCTGGG + Intergenic
1022407352 7:30103091-30103113 AGAGATTACCAGGTGCTGGAGGG + Intronic
1023420882 7:39978388-39978410 AGAGGTGACCAGTTGCAGAATGG + Intronic
1026258781 7:68736114-68736136 AGAACTCACTAGTTACTGCAGGG - Intergenic
1026402270 7:70026470-70026492 AGAGCTTACTTGTTGTTCCAAGG + Intronic
1030127287 7:106166355-106166377 AGCAGTATCTAGTTGCTGCAGGG + Intergenic
1030349532 7:108468642-108468664 AGCTGTTACTAGTTGCTGGGGGG + Intergenic
1032997559 7:137464612-137464634 AGAGGACACAAGTGGCTGCATGG - Intronic
1036297014 8:7545451-7545473 AGAGGATCCCAGATGCTGCAGGG + Intergenic
1036325555 8:7775568-7775590 AGAGGATCCCAGATGCTGCAGGG - Intergenic
1038223013 8:25628527-25628549 AGAGGTTTCTAGGGGCTGGAAGG + Intergenic
1038313608 8:26464680-26464702 GGAGGTTACTGGTAGATGCAGGG - Intronic
1039923989 8:41912459-41912481 AGTGGTTACCAGGGGCTGCAGGG - Intergenic
1040994368 8:53387297-53387319 AGAGGTGCCTGGTTGCTGAAGGG + Intergenic
1041896465 8:62930229-62930251 GGAGGTTACTAGAGGCTGGAGGG - Intronic
1042096907 8:65226247-65226269 AGATCATTCTAGTTGCTGCATGG + Intergenic
1042676419 8:71326864-71326886 AGAGGTCACTGTTTGATGCATGG - Intronic
1043725012 8:83600372-83600394 TGAGGTTACTAGTTTCTGTTTGG - Intergenic
1045263560 8:100598809-100598831 AGAGGTAAGTAGTTGCAACAGGG - Intronic
1045288658 8:100813137-100813159 AGACGTTACTGCTTGCTGTAGGG - Intergenic
1046555977 8:115774040-115774062 TGAGGTTAATAATTGCTCCATGG - Intronic
1047151597 8:122270099-122270121 AGTGGTTACTAGGGGCTGGATGG + Intergenic
1047737644 8:127780673-127780695 AGAGGTTCATAGTTGGGGCAAGG - Intergenic
1048117094 8:131535842-131535864 AGTGGTTACTAATTGGTACAGGG - Intergenic
1050494115 9:6221700-6221722 AGAGGTTACTAGTTGCTGCATGG - Intronic
1187684388 X:21801783-21801805 AGAGGTTACCAGAGGCTGAAGGG + Intergenic
1188589927 X:31821241-31821263 AGACCTTGCTAATTGCTGCATGG + Intronic
1192307605 X:69979071-69979093 AGAGGTGACCAGGGGCTGCAGGG - Intronic
1193363535 X:80603492-80603514 AGAGGTTACCAGGAGCTGAAGGG - Intergenic
1194618945 X:96144184-96144206 AGAGGTTACTAGTGGCTGTGGGG + Intergenic
1195434321 X:104825185-104825207 AGAGGTTCCTAGATGCTAAAGGG + Intronic
1195492163 X:105483595-105483617 AGAGGTTAATATTCGCTGGAAGG - Intronic
1195712859 X:107788749-107788771 AGAGGTTTCTAGTTGATGTTAGG - Intronic
1201579549 Y:15496169-15496191 AGAGGTTGCTGGTGGGTGCATGG - Intergenic