ID: 1050494945

View in Genome Browser
Species Human (GRCh38)
Location 9:6230731-6230753
Sequence AGGATCTATGAGGATATAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050494945_1050494951 10 Left 1050494945 9:6230731-6230753 CCCACTATATCCTCATAGATCCT 0: 1
1: 0
2: 0
3: 14
4: 158
Right 1050494951 9:6230764-6230786 AAGAGAAACCAAGCTTGACAAGG No data
1050494945_1050494953 29 Left 1050494945 9:6230731-6230753 CCCACTATATCCTCATAGATCCT 0: 1
1: 0
2: 0
3: 14
4: 158
Right 1050494953 9:6230783-6230805 AAGGAGATGAATCAAATATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050494945 Original CRISPR AGGATCTATGAGGATATAGT GGG (reversed) Intronic
901159475 1:7163835-7163857 AGGTGCTAAGAGCATATAGTGGG - Intronic
901644911 1:10711329-10711351 AGGATCTAATAGCATGTAGTAGG - Intronic
907111200 1:51928066-51928088 AGGAACTTTGAGGATATGGAAGG + Intronic
912406311 1:109441081-109441103 AGGATCATTCAGAATATAGTTGG - Intergenic
915017784 1:152752030-152752052 AGGATCAATGATGATATATATGG - Intronic
917684084 1:177398183-177398205 AGGATATATGAGAAAATATTAGG - Intergenic
1064920968 10:20517784-20517806 ATAATCTATGGGGACATAGTGGG + Intergenic
1066790428 10:39056363-39056385 AGAATCTGTGAGGAGATATTTGG + Intergenic
1066929283 10:41736510-41736532 AGAATCTGTGAGGAAATATTTGG + Intergenic
1067941929 10:50664094-50664116 TGGATCTGTGAGTATATCGTGGG - Intergenic
1069400377 10:68038254-68038276 ATGACCTATGTGCATATAGTAGG - Intronic
1069677953 10:70262223-70262245 AACATCTATCAGGATATGGTTGG + Intronic
1070863172 10:79689045-79689067 TGGATCTGTGAGTATATCGTGGG - Intergenic
1070895997 10:79983253-79983275 AGGAACTATGAGAAAATAGTTGG - Intergenic
1073594134 10:104783752-104783774 AGGATCTAGGATGATGAAGTTGG + Intronic
1073791575 10:106945475-106945497 AGGAACTATGAGGATGTGGAAGG + Intronic
1074661026 10:115657961-115657983 AAGATTTATGAGAATATATTTGG - Intronic
1074703017 10:116109041-116109063 AGGTTCTATGTGAATGTAGTTGG - Intronic
1082302774 11:50530160-50530182 AGGATCTGTGAGGGGATACTTGG + Intergenic
1082310680 11:50643966-50643988 AGAATCTATGAAGAAATATTTGG + Intergenic
1082571466 11:54745393-54745415 AGGATCTTTGAGGAAATGTTTGG - Intergenic
1082580199 11:54856724-54856746 AGAATCTATGAAGAGATACTTGG + Intergenic
1082589047 11:54982464-54982486 AGGATCTGTGAAGAGATATTTGG + Intergenic
1082592158 11:55025389-55025411 AGTATCTATGAAGGTATATTTGG - Intergenic
1082598432 11:55114928-55114950 AGGATCTACGAAGAGATATTTGG + Intergenic
1087242243 11:95791977-95791999 AGGATCTAGGGGGAAAGAGTTGG + Intronic
1091953497 12:4615635-4615657 GGGCTCTGTGAGGATATAGAGGG + Exonic
1092881251 12:12889465-12889487 TGGGTTTTTGAGGATATAGTTGG + Intergenic
1094114042 12:26890864-26890886 AGGATCTAAGTGGAAATAGTCGG - Intergenic
1094864743 12:34518351-34518373 AGGATCTGTGAAGGTATATTTGG - Intergenic
1094877111 12:34661447-34661469 AGAATCTGTGAGGAGATATTTGG + Intergenic
1095073122 12:37882395-37882417 AGAATCTGTGAAGATATATTTGG - Intergenic
1095078285 12:37961940-37961962 AGAATCTGTGAAGATATATTTGG + Intergenic
1095079955 12:37987824-37987846 AGAATCTGTGAAGATATATTTGG + Intergenic
1097225324 12:57473842-57473864 AAGAATTATGAGGCTATAGTTGG - Intronic
1098039564 12:66340524-66340546 AGGATATATGTGGATATAAAAGG + Exonic
1098823328 12:75260943-75260965 AGCATTTATAAGGATAAAGTGGG - Intergenic
1101842136 12:108335407-108335429 AGGATATCTGAGGAGAGAGTGGG + Intronic
1104801217 12:131556270-131556292 AGCATCCCTGAGGATATAGGAGG + Intergenic
1106779300 13:33041053-33041075 AGGATCTAGGAGGACAAAATGGG - Intronic
1107676336 13:42801632-42801654 ATTTTCTATGAGGATATTGTTGG + Intergenic
1108937251 13:55898479-55898501 AGAATATATGAGGACATGGTTGG - Intergenic
1109815007 13:67569913-67569935 AGGATCTATGTTGTTATTGTGGG + Intergenic
1111958492 13:94783665-94783687 AGGATCTTTGCAGATGTAGTTGG + Intergenic
1112609650 13:100943949-100943971 AAGATCTTTGAGGATAGAGATGG + Intergenic
1112727647 13:102322945-102322967 AGGATCAAAGAGGTTAAAGTAGG - Intronic
1114418679 14:22561460-22561482 AGGATCTTAGAGGAGAGAGTAGG - Intergenic
1117512738 14:56470189-56470211 AGGATCCGTGAGGATGGAGTGGG + Intergenic
1119055769 14:71418431-71418453 ATGAACTATGTGGATGTAGTTGG + Intronic
1120513148 14:85439461-85439483 AGGACTTATGAAAATATAGTCGG + Intergenic
1125562850 15:40651210-40651232 AGGATCCATGAAGATATCCTTGG - Intronic
1126462787 15:48930962-48930984 AGGAACTTTGAGGAAGTAGTTGG - Intronic
1126990184 15:54365661-54365683 AGGATTTATGATGAAAGAGTTGG + Intronic
1129171316 15:73809887-73809909 AGGCTCCATGGGGATGTAGTTGG + Intergenic
1132848633 16:2013251-2013273 AGGAGTTCTGAGGATATAGTGGG + Intronic
1136739133 16:32497709-32497731 AGAATCTTTGAGGTTATATTTGG + Intergenic
1138991955 16:62401275-62401297 AGTATCTAGGAAGATATAGATGG + Intergenic
1203012261 16_KI270728v1_random:306837-306859 AGAATCTATGAGGGAATATTTGG + Intergenic
1203014079 16_KI270728v1_random:334083-334105 AGAATCTTTGAGGTTATATTTGG - Intergenic
1203030596 16_KI270728v1_random:579996-580018 AGAATCTATGAGGGAATATTTGG + Intergenic
1203032414 16_KI270728v1_random:607242-607264 AGAATCTTTGAGGTTATATTTGG - Intergenic
1203041125 16_KI270728v1_random:754435-754457 AGAATCTATGAGGGAATATTTGG - Intergenic
1146138604 17:30345067-30345089 AGCATCTAGGAGGAAGTAGTGGG + Intergenic
1150291018 17:63982248-63982270 AGGTTCTAGAAGGATATAATGGG - Intergenic
1155466070 18:26136744-26136766 AAGATCTCTGAGGATCTAGATGG + Intronic
1158093946 18:53748860-53748882 AGGATATATGGGGAAATAGGGGG + Intergenic
1158348276 18:56538019-56538041 AGGTTCAATGAGGTTATAGGTGG + Intergenic
1159454708 18:68645796-68645818 AGGAGAAATGAGGATGTAGTGGG + Intergenic
1163157395 19:15446938-15446960 AGGATCTGTGAGGATGCAGCAGG + Intronic
1164328698 19:24229670-24229692 AGAATCTATGAAGGTATATTTGG - Intergenic
1164330695 19:24251967-24251989 AGAATGTATGAGGAAATATTTGG - Intergenic
1164339963 19:24382960-24382982 AGAATCTATGAGGGAATATTTGG + Intergenic
1164362553 19:27531295-27531317 AGGATCTATGAAGAGATATATGG + Intergenic
1164363022 19:27539094-27539116 AGAATCTGTGAAGATATATTTGG + Intergenic
1164363414 19:27544814-27544836 AGAATGTATGAGGAAATATTTGG + Intergenic
1166359265 19:42245887-42245909 AGGATCTCAGAGGATATGGATGG + Intronic
924989552 2:300747-300769 AGCATCTAAGAGGATATGGGTGG - Intergenic
927694147 2:25229149-25229171 AGGGTCTTTGAGGATCGAGTTGG - Exonic
930601992 2:53454260-53454282 ATGATCTATGAGGAAACTGTGGG + Intergenic
932500618 2:72179852-72179874 AGGTCCTATCAGGATTTAGTAGG - Intronic
932787286 2:74618070-74618092 AGCTTCTATGATGATATGGTTGG + Intronic
933280440 2:80327066-80327088 AGGAGTTATGAGGATCTAGCTGG - Intronic
936904337 2:117519759-117519781 AGGATCTCTGAAGATGGAGTGGG + Intergenic
937406764 2:121636929-121636951 TAGATCTATGTGGATATATTTGG - Intronic
938552613 2:132395088-132395110 AGGAGCAGTGAGTATATAGTGGG - Intergenic
939836223 2:147132862-147132884 AGGATTTATGAAAATATAATGGG + Intergenic
940033250 2:149287080-149287102 AGGCTCTTTGAGGTTATAGTAGG - Intergenic
941735126 2:168965818-168965840 AGGCTAGATGAGCATATAGTAGG - Intronic
944130216 2:196339583-196339605 AGGATAGATGAGGAGATAGATGG + Intronic
947957416 2:234204538-234204560 AAGATCTATGAGTATTCAGTAGG - Intergenic
1170235719 20:14102766-14102788 AGGATATATGGGGATATATGGGG + Intronic
1173366138 20:42387003-42387025 AGGAACTTAGAGGATCTAGTGGG - Intronic
1174043893 20:47719625-47719647 AGGATTTATTAGAATATAGGTGG - Intronic
1174224773 20:48988578-48988600 AGCATCTATGAAGAGATAGAAGG + Exonic
1177841632 21:26240901-26240923 TGGATCTCTGAGGATAAAGTTGG - Intergenic
1179367457 21:40771666-40771688 AGGAAGTATGAAGATATAGTGGG + Intronic
1180669779 22:17544038-17544060 AGGAACTATGATGATGCAGTGGG - Intronic
1181878967 22:25962173-25962195 AGGATGCATGAGGATAAAGGCGG - Intronic
950364124 3:12471203-12471225 AGGAGCGATGTGGATACAGTGGG - Intergenic
951074417 3:18372111-18372133 AGGTTCTATGAATACATAGTTGG + Intronic
952769919 3:36990010-36990032 AGGATCTATGAATATAAATTGGG + Exonic
956979775 3:74622345-74622367 AGGGTCTTTGCAGATATAGTTGG + Intergenic
959792919 3:110386359-110386381 AGGCACTAAGAGGATATAATGGG + Intergenic
959884332 3:111481286-111481308 AGGCTTTGTGAGGATATAGGTGG - Intronic
961988712 3:131165009-131165031 AGGATTTATGAGGAAATATCTGG - Intronic
963086728 3:141443968-141443990 ATGATTTTTGAGTATATAGTAGG - Exonic
964470476 3:157048149-157048171 AGGAACCATGGGGATAAAGTAGG + Intergenic
966993556 3:185258002-185258024 AGGATGTATGATGATATTGGTGG - Intronic
967156439 3:186696667-186696689 AGGATCTATTAGGATTGTGTGGG + Intergenic
971059872 4:22955572-22955594 AGGATCTATAAGTATAGAGATGG + Intergenic
971531420 4:27693672-27693694 AGGTTCTAGGAAGATAAAGTTGG - Intergenic
972942526 4:44214270-44214292 AGGAGCTAGGAGGATAGAGGGGG + Intronic
973148610 4:46860651-46860673 AGGGGCAATGATGATATAGTTGG - Intronic
973757170 4:54086816-54086838 ATGGTCTAGGAGGATACAGTGGG - Intronic
974198872 4:58612932-58612954 AGGATATATCAGGAAATAGTAGG - Intergenic
974841955 4:67309002-67309024 AGGACCAATGAGGCGATAGTTGG - Intergenic
977233555 4:94480419-94480441 AGGATCTATGGGTATATGGTGGG + Intronic
977520294 4:98074025-98074047 AGGATCTGTGTGTATATATTTGG + Intronic
979346727 4:119595805-119595827 AGGATATATGAGGATATATGAGG - Intronic
979806328 4:124976517-124976539 AGGAACTAGTAGGATATGGTAGG - Intergenic
989846146 5:46144776-46144798 AGAATCTGTGAAGATATATTTGG + Intergenic
989849573 5:46192696-46192718 AGGATCTATGAAGGGATATTTGG - Intergenic
989852704 5:46235271-46235293 AGGACCTATGAAGAGATATTTGG - Intergenic
989855614 5:46285245-46285267 AGAATCTGTGAGGATATATTTGG - Intergenic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
998928785 5:147157391-147157413 AGGATCTTTGAGCATAGTGTGGG - Intergenic
1003274416 6:4637102-4637124 AGGAGCTATGAGGATTTTGAGGG - Intergenic
1005472484 6:26175337-26175359 GGGATCTAGGAGGAAATAGAAGG + Intergenic
1009249906 6:61285738-61285760 AGAATCTATGAAGAGATAATAGG - Intergenic
1009260295 6:61477940-61477962 AGTATCTGTGAAGGTATAGTGGG + Intergenic
1009261781 6:61499896-61499918 AGAATCTATGAAGGTATATTTGG - Intergenic
1009854656 6:69246571-69246593 AGGGACTAGGAGGTTATAGTAGG - Intronic
1017779796 6:157706939-157706961 AGGATCTATGATGAGATAATAGG + Intronic
1017911524 6:158796845-158796867 AGGATTTTTCAGAATATAGTTGG + Intronic
1022360185 7:29649845-29649867 AGGGACTATGAGAAAATAGTCGG + Intergenic
1022360291 7:29650360-29650382 AGGAACTATGAGAAAATAGTCGG + Intergenic
1022360330 7:29650657-29650679 AGGGACTATGAGAAAATAGTCGG + Intergenic
1022974314 7:35543770-35543792 AGGATCCAGGAGGATACAGGAGG + Intergenic
1023632222 7:42176221-42176243 TGGATCTTTGAGGATATCTTTGG - Intronic
1025528881 7:61851077-61851099 AGAATCTATGAGGGAATATTTGG - Intergenic
1025529171 7:61855564-61855586 AGAATCTGTGAGGGTATATTTGG - Intergenic
1025575646 7:62637542-62637564 AGGATCTGTGAAGGTATATTTGG - Intergenic
1025584410 7:62764540-62764562 AGAATCTATGAGGGGATATTTGG - Intergenic
1025589890 7:62844580-62844602 AGAATCTGTGAGGAGATATTTGG + Intergenic
1025596565 7:62935066-62935088 AGAATCTGTGAAGATATATTTGG - Intergenic
1025598385 7:62961734-62961756 AGAATCTATGAAGAGATATTTGG + Intergenic
1027411020 7:77917957-77917979 ATGAACTTTGAGGAGATAGTGGG + Intronic
1028590480 7:92488161-92488183 AGGATGTATGTGGATAAAGGGGG + Intronic
1037125998 8:15350419-15350441 AGGATTTTTTAGCATATAGTGGG - Intergenic
1040274866 8:46005276-46005298 AGAATCTGTGAAGATATATTTGG + Intergenic
1040594808 8:48826971-48826993 AGGATGTCAGAGGATACAGTGGG + Intergenic
1044402009 8:91783511-91783533 ATGATGTATGTGTATATAGTAGG + Intergenic
1044761979 8:95529013-95529035 AGGCTAAATGAGGATATATTAGG + Intergenic
1045393655 8:101739190-101739212 AGGAGCCATGAGGACATGGTGGG - Intronic
1045566370 8:103320088-103320110 AGGATGGCTGTGGATATAGTAGG + Intronic
1048360396 8:133692514-133692536 AGGATTCATGAGGTTAGAGTGGG + Intergenic
1048817734 8:138349501-138349523 AGGATATAGCAGGATATAGTAGG + Intronic
1050494945 9:6230731-6230753 AGGATCTATGAGGATATAGTGGG - Intronic
1050612693 9:7369531-7369553 AGAATCTATGAGGCTACAGCAGG - Intergenic
1054894348 9:70291263-70291285 AGGATCTCTGTGTATATATTGGG + Intronic
1058998500 9:110323677-110323699 AGAATCTATGGGGATAGTGTAGG + Intronic
1059014935 9:110505403-110505425 AGGGTCTATGGGGATAGATTTGG - Intronic
1059739406 9:117135017-117135039 AGGAGCTATGAGGCTCTAGAAGG - Intronic
1059765492 9:117380057-117380079 AGGATGTGAGAGGATATAGCAGG + Intronic
1059983809 9:119801903-119801925 AAGCTCTAAGAGAATATAGTTGG - Intergenic
1187354755 X:18557458-18557480 AGTATCTACGAGGATATAGAGGG - Intronic
1188202438 X:27308081-27308103 TGGATATATGAGGATCCAGTTGG + Intergenic
1191264020 X:58364045-58364067 AGAATCTGTGAGGAGATATTTGG + Intergenic
1194001094 X:88429429-88429451 AGCATCAATGAGGATATTGATGG - Intergenic
1197641983 X:128977021-128977043 AGGATAAATGAGAATATACTAGG - Intergenic
1198641404 X:138760017-138760039 GGGGTGTATGAGGATGTAGTGGG + Intronic
1198919769 X:141712539-141712561 AGGATCCATGAGAATAAAGGAGG + Intergenic
1201424508 Y:13833478-13833500 AGAAATTATGAGGATATAGATGG - Intergenic