ID: 1050494946

View in Genome Browser
Species Human (GRCh38)
Location 9:6230732-6230754
Sequence GAGGATCTATGAGGATATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050494946_1050494951 9 Left 1050494946 9:6230732-6230754 CCACTATATCCTCATAGATCCTC 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1050494951 9:6230764-6230786 AAGAGAAACCAAGCTTGACAAGG No data
1050494946_1050494953 28 Left 1050494946 9:6230732-6230754 CCACTATATCCTCATAGATCCTC 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1050494953 9:6230783-6230805 AAGGAGATGAATCAAATATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050494946 Original CRISPR GAGGATCTATGAGGATATAG TGG (reversed) Intronic
900873796 1:5326695-5326717 GAGGATCAATGAGGACATTGAGG - Intergenic
903094380 1:20955746-20955768 GGGTATCTATGAGGAGAGAGGGG + Intronic
906271594 1:44483662-44483684 GAGGAGCTATGAGAACATAGCGG + Intronic
907289062 1:53401271-53401293 GAGGAGCTGTGAGGGTGTAGGGG + Intergenic
907815068 1:57910687-57910709 GAGCATCTATTAGGGTATATTGG - Intronic
908046967 1:60181058-60181080 GAAAATCAATAAGGATATAGAGG - Intergenic
910584786 1:88867229-88867251 GAGCATATATGAAAATATAGTGG - Intronic
911498212 1:98656317-98656339 GAGGATTTATAAGGATATTCAGG - Intergenic
912349980 1:109003189-109003211 GAAGATCAATAAGGATATAGAGG - Intronic
915990211 1:160507489-160507511 GAAGATCAATAAGGAAATAGAGG + Intronic
916090898 1:161306916-161306938 GAAGATCTATGAGGAATGAGGGG + Exonic
917987078 1:180331708-180331730 GAGGATATTTAAGGAAATAGGGG + Intronic
918128960 1:181608277-181608299 GAGGAACGATGAGGATATCCAGG + Intronic
919039450 1:192364345-192364367 AAAGATCTATGAGCAAATAGTGG + Intronic
924074469 1:240318929-240318951 GAGGATCACTGAAGATTTAGAGG + Intronic
924557677 1:245131575-245131597 GAGTATCACTGAGGAAATAGAGG + Intergenic
1065614886 10:27510503-27510525 GAGAATATATGAGAAGATAGAGG + Intronic
1069313279 10:67066039-67066061 GATGATCTATGAGGTTATTTAGG + Intronic
1074268494 10:111929187-111929209 GAGGATCTATGAAATTAAAGAGG - Intergenic
1075604955 10:123798039-123798061 GAGGGTTTATGCGGATGTAGCGG + Exonic
1075927387 10:126263443-126263465 GAGGATCTAGTGTGATATAGGGG - Intronic
1080428560 11:32178200-32178222 GAGGATCTTTGAGCAGATACAGG - Intergenic
1084105556 11:66977874-66977896 GAGATTCTCTGAGGATAAAGAGG - Intergenic
1087819425 11:102695066-102695088 GAGGATCTATTATGATATCACGG - Exonic
1088703935 11:112443638-112443660 GAAGATCAATAAGGAAATAGAGG - Intergenic
1088845854 11:113666265-113666287 GAAGATCAATAAGGAAATAGTGG - Intergenic
1089302713 11:117508202-117508224 CAGGATCTGAAAGGATATAGGGG - Intronic
1090912071 11:131129713-131129735 CAGGGCCTATGAGGATCTAGGGG + Intergenic
1091707527 12:2707493-2707515 GAGGATAAATAAGGAAATAGAGG + Intergenic
1091914064 12:4255263-4255285 CAGTATCAATGAGGATATCGAGG + Intergenic
1091953496 12:4615634-4615656 AGGGCTCTGTGAGGATATAGAGG + Exonic
1092828220 12:12417737-12417759 GAGGATCAATGAGGAGGCAGAGG - Intronic
1095350208 12:41201298-41201320 GAGGATATTTGAGGATACAAAGG - Intronic
1095441112 12:42239050-42239072 AAGGACTTATGAGTATATAGGGG - Intronic
1097755782 12:63405388-63405410 GATGATCTAAGGGAATATAGAGG - Intergenic
1097900989 12:64873731-64873753 GAGGAACTATGAGAATGTAATGG + Intronic
1101842135 12:108335406-108335428 GAGGATATCTGAGGAGAGAGTGG + Intronic
1106799006 13:33236629-33236651 GTGCATCTATGTGGATACAGGGG + Intronic
1109687951 13:65844872-65844894 TAGGGTCTATGAGGATATTCAGG - Intergenic
1110053908 13:70940573-70940595 GAGGATACTTGAGGATATAATGG + Intergenic
1110762003 13:79241215-79241237 GAGGCTCCATGAGGATAAGGGGG - Intergenic
1112240915 13:97680183-97680205 GAGGCTCTGTCATGATATAGGGG - Intergenic
1112682794 13:101786552-101786574 GAAGACCTGTGAGGATACAGGGG - Intronic
1112990473 13:105507110-105507132 TGGGAGCTCTGAGGATATAGGGG + Intergenic
1119930670 14:78543061-78543083 GAGTACCTATGAGGCTACAGTGG - Intronic
1120741348 14:88112029-88112051 GAGGATGTATCAGAAGATAGAGG - Intergenic
1121583908 14:95049881-95049903 GAGGATGTAGAAGGATATATTGG + Intergenic
1127341898 15:58054684-58054706 GAGGATGTGTGAGGCTATTGAGG - Intronic
1129060298 15:72855783-72855805 GAGGATCAGTGAGGACATGGAGG + Intergenic
1129962886 15:79704442-79704464 GAAGATATATGAGAATAAAGAGG - Intergenic
1132307149 15:100824583-100824605 TAGGTTCTATGAGACTATAGAGG + Intergenic
1132848632 16:2013250-2013272 CAGGAGTTCTGAGGATATAGTGG + Intronic
1147250329 17:39149414-39149436 GAGGACCTATGAGGAGGAAGCGG - Intronic
1149149594 17:53544577-53544599 GAGGAGCTGTTAGGAAATAGAGG - Intergenic
1153575801 18:6519795-6519817 GAAGATCAATGAGGAAATAAAGG - Intronic
1158093945 18:53748859-53748881 GAGGATATATGGGGAAATAGGGG + Intergenic
1158289463 18:55923010-55923032 GTGGATCTCTATGGATATAGGGG + Intergenic
1158569136 18:58581952-58581974 GAGGGTTTATGAGGACATATAGG - Intronic
1159454707 18:68645795-68645817 GAGGAGAAATGAGGATGTAGTGG + Intergenic
1160398718 18:78592213-78592235 GAAGATCAATAAGGAAATAGAGG + Intergenic
925719050 2:6810654-6810676 AAGAATCTGTGAGTATATAGAGG + Intergenic
935517550 2:104060513-104060535 GAAGATCAATAAGGATTTAGAGG + Intergenic
936904336 2:117519758-117519780 GAGGATCTCTGAAGATGGAGTGG + Intergenic
938552614 2:132395089-132395111 GAGGAGCAGTGAGTATATAGTGG - Intergenic
942313785 2:174680853-174680875 GAGGATCTAGTAGGATAATGGGG - Intronic
946126389 2:217566701-217566723 GAGGAGGTATGAGGATAAAGGGG + Intronic
948346933 2:237306501-237306523 GAGGATCTATGCAGATTTATGGG - Intergenic
1169391472 20:5194658-5194680 GATGATTTATGAGAATAGAGGGG + Exonic
1170235718 20:14102765-14102787 TAGGATATATGGGGATATATGGG + Intronic
1171103269 20:22406767-22406789 GATCATATATGAGAATATAGAGG + Intergenic
1173230887 20:41196126-41196148 GAAGATCAATCAGGAAATAGAGG - Intronic
1173716686 20:45213781-45213803 GAGGATATTTGAAGATATAATGG - Intergenic
1179367456 21:40771665-40771687 AAGGAAGTATGAAGATATAGTGG + Intronic
1180669780 22:17544039-17544061 GAGGAACTATGATGATGCAGTGG - Intronic
1182718606 22:32379054-32379076 TAGGATCCATGAGGAGAGAGAGG + Intronic
949713462 3:6899059-6899081 GAGGATCTAATAAGAAATAGAGG + Intronic
950210152 3:11117197-11117219 GAGGAGCTATGAGGATACCTGGG - Intergenic
950942791 3:16910711-16910733 AAAGATCTAGTAGGATATAGTGG - Intronic
952769918 3:36990009-36990031 GAGGATCTATGAATATAAATTGG + Exonic
953630930 3:44616546-44616568 GAAGATCAATAAGGAAATAGAGG + Intronic
955040479 3:55313078-55313100 GAGGAATTATGAGGAAATTGAGG - Intergenic
955262003 3:57400818-57400840 GAAGATCAATAAGGAAATAGAGG + Intronic
957545576 3:81631998-81632020 GAGAACATATGAGGATAGAGAGG - Intronic
960035989 3:113103604-113103626 CAAGATCTCTGAGGATACAGAGG + Intergenic
962921342 3:139953246-139953268 GAGGATCTGTGTGGGCATAGAGG - Intronic
963389796 3:144646464-144646486 AAGTATTTGTGAGGATATAGAGG - Intergenic
966281013 3:178229125-178229147 GAAGATCAATAAGGAAATAGAGG - Intergenic
967156438 3:186696666-186696688 GAGGATCTATTAGGATTGTGTGG + Intergenic
971956065 4:33419956-33419978 GAGGTTCTACTAGGATGTAGTGG - Intergenic
972213235 4:36863839-36863861 GGGGAACTATGAGGATATAATGG + Intergenic
972942525 4:44214269-44214291 AAGGAGCTAGGAGGATAGAGGGG + Intronic
972975744 4:44633546-44633568 GAGCATCTATAAGGAGATAGAGG + Intronic
973757171 4:54086817-54086839 GATGGTCTAGGAGGATACAGTGG - Intronic
977233554 4:94480418-94480440 CAGGATCTATGGGTATATGGTGG + Intronic
980700604 4:136423812-136423834 GAGGTTCTAAGAAGATATACTGG + Intergenic
980902099 4:138914818-138914840 GGGGATCTATGTGGCTCTAGGGG + Intergenic
982048570 4:151475491-151475513 GATGATATATGAGGATATCTGGG + Intronic
982529149 4:156516665-156516687 GAGAAAGTATGAGGAGATAGTGG - Intergenic
983486498 4:168337789-168337811 GAGGAGGTATGAGGATGTGGAGG - Intergenic
984153448 4:176163867-176163889 GAGGCTCTATTAGGAAATATGGG + Intronic
986150461 5:5125129-5125151 GAGGATGGAGGAGGATAGAGAGG + Intergenic
987968348 5:24907362-24907384 GACAATCTTTGAGGAAATAGAGG - Intergenic
988337346 5:29923430-29923452 GAGGAACTAAGAGGATTTTGGGG - Intergenic
990237612 5:53784523-53784545 GCTGATCTCTTAGGATATAGGGG - Intergenic
990968592 5:61477781-61477803 GAGAAGCTATCAGGATACAGAGG - Intronic
991651704 5:68862303-68862325 GAGGATCTCTGAGCAGAGAGGGG - Intergenic
996588495 5:125118581-125118603 GAGGAGCTAGGGGGAAATAGAGG + Intergenic
997019010 5:129974552-129974574 GAGGAACTATAAGTACATAGGGG - Intronic
997810966 5:136969576-136969598 GAAGATCAGTGAGGAAATAGAGG - Intergenic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
1003211171 6:4068156-4068178 GAGGAGCTAGGAGGATCTAGAGG + Intronic
1003274417 6:4637103-4637125 AAGGAGCTATGAGGATTTTGAGG - Intergenic
1005005162 6:21280725-21280747 GAGGATTGATGAGAATATATAGG - Intergenic
1010787050 6:80015906-80015928 GAGGATCAAGGAGGTTATTGAGG - Intronic
1013284610 6:108670452-108670474 GAGGATCTATGACTATCTTGAGG - Intronic
1015874799 6:137812017-137812039 AAGGAGCTATGAGGGTAGAGAGG + Intergenic
1021063317 7:16141231-16141253 AAGGATTTAGGAAGATATAGGGG - Intronic
1021242781 7:18224905-18224927 GAGGAAGTTGGAGGATATAGAGG + Intronic
1021260557 7:18451670-18451692 ACTGATCTATGTGGATATAGAGG + Intronic
1023137760 7:37070185-37070207 GAGGATGTAAGAGGATGCAGTGG - Intronic
1024743381 7:52379502-52379524 GATGGTTGATGAGGATATAGAGG + Intergenic
1027190441 7:75993232-75993254 GAGGAGCTGAGAGGATAGAGGGG - Intronic
1028590479 7:92488160-92488182 CAGGATGTATGTGGATAAAGGGG + Intronic
1029225453 7:99024107-99024129 GAGGATCAATAAGGAAATACAGG + Intergenic
1037189338 8:16103273-16103295 GAAGATCAATAAGGAGATAGAGG - Intergenic
1041873734 8:62664095-62664117 GGGGATCTACCAGGAAATAGAGG - Intronic
1042876101 8:73441119-73441141 GAGGAGCTATGAGAATATAAGGG - Intronic
1045310211 8:100994631-100994653 CAGGGTATATGAGGACATAGGGG - Intergenic
1047913801 8:129560153-129560175 GAGGATCAATGAAGATAAAGTGG - Intergenic
1050010877 9:1184823-1184845 GATGATTTAGGAGGAGATAGCGG + Intergenic
1050494946 9:6230732-6230754 GAGGATCTATGAGGATATAGTGG - Intronic
1052775219 9:32726403-32726425 GAGGAACTATGAGGCAAGAGGGG + Intergenic
1054894347 9:70291262-70291284 GAGGATCTCTGTGTATATATTGG + Intronic
1056271374 9:84951109-84951131 GTGGATCCATGAGGCTAAAGAGG - Intronic
1058915376 9:109559667-109559689 GAGGATCTAGTAGGACACAGGGG - Intergenic
1059949539 9:119448015-119448037 GAGGAAATATGAGGATCTAAAGG - Intergenic
1060950516 9:127599222-127599244 GAGGATCTAGGAGGACAGATGGG - Intergenic
1187354756 X:18557459-18557481 CAGTATCTACGAGGATATAGAGG - Intronic
1189374647 X:40457401-40457423 GAGAAACTAGGAGGATGTAGAGG + Intergenic
1190093980 X:47464115-47464137 GAGGAGGTATCAGGAAATAGAGG - Intronic
1193724809 X:85026068-85026090 GAGGATATATGAGGATACTGAGG - Intronic
1196814920 X:119657381-119657403 GAGAAGCTTTGAGGATAGAGAGG - Intronic
1197710887 X:129666348-129666370 AAGGAGCTAAGAGGATATGGAGG - Intergenic
1199418524 X:147615608-147615630 GAGGCTTTCTGAGGAGATAGAGG - Intergenic
1199564649 X:149202213-149202235 GAAGATCAATTAGGAAATAGAGG - Intergenic