ID: 1050501459

View in Genome Browser
Species Human (GRCh38)
Location 9:6302457-6302479
Sequence CTGTTCATGAACAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050501459_1050501466 12 Left 1050501459 9:6302457-6302479 CCTTCCTCCTTGTTCATGAACAG No data
Right 1050501466 9:6302492-6302514 CTGTCAATAAACATTTGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050501459 Original CRISPR CTGTTCATGAACAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr