ID: 1050506750

View in Genome Browser
Species Human (GRCh38)
Location 9:6356660-6356682
Sequence TTATTACCAAAGATTGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050506745_1050506750 20 Left 1050506745 9:6356617-6356639 CCCAAATGGCAGAAGTTCTGCTG No data
Right 1050506750 9:6356660-6356682 TTATTACCAAAGATTGCCCAGGG No data
1050506746_1050506750 19 Left 1050506746 9:6356618-6356640 CCAAATGGCAGAAGTTCTGCTGC No data
Right 1050506750 9:6356660-6356682 TTATTACCAAAGATTGCCCAGGG No data
1050506744_1050506750 23 Left 1050506744 9:6356614-6356636 CCTCCCAAATGGCAGAAGTTCTG No data
Right 1050506750 9:6356660-6356682 TTATTACCAAAGATTGCCCAGGG No data
1050506747_1050506750 -3 Left 1050506747 9:6356640-6356662 CCACTATTAAACATTAGCCATTA No data
Right 1050506750 9:6356660-6356682 TTATTACCAAAGATTGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050506750 Original CRISPR TTATTACCAAAGATTGCCCA GGG Intergenic
No off target data available for this crispr