ID: 1050515893

View in Genome Browser
Species Human (GRCh38)
Location 9:6444321-6444343
Sequence GATGGTAATCAAAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050515886_1050515893 12 Left 1050515886 9:6444286-6444308 CCTCTAACTGTCTATGACTTGTA 0: 1
1: 0
2: 0
3: 11
4: 94
Right 1050515893 9:6444321-6444343 GATGGTAATCAAAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050515893 Original CRISPR GATGGTAATCAAAAGGAGGA AGG Intronic
No off target data available for this crispr