ID: 1050518271

View in Genome Browser
Species Human (GRCh38)
Location 9:6468905-6468927
Sequence TTATCTCTCCAGCAGTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050518266_1050518271 24 Left 1050518266 9:6468858-6468880 CCAGCCTTGACTCAGCATAGATG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1050518271 9:6468905-6468927 TTATCTCTCCAGCAGTAGGAAGG No data
1050518267_1050518271 20 Left 1050518267 9:6468862-6468884 CCTTGACTCAGCATAGATGCTGA 0: 1
1: 0
2: 1
3: 17
4: 129
Right 1050518271 9:6468905-6468927 TTATCTCTCCAGCAGTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050518271 Original CRISPR TTATCTCTCCAGCAGTAGGA AGG Intronic
No off target data available for this crispr