ID: 1050531777

View in Genome Browser
Species Human (GRCh38)
Location 9:6596894-6596916
Sequence TGTAATGTTTTCAGTTCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1144
Summary {0: 1, 1: 1, 2: 16, 3: 101, 4: 1025}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050531777_1050531779 14 Left 1050531777 9:6596894-6596916 CCAAAAGAACTGAAAACATTACA 0: 1
1: 1
2: 16
3: 101
4: 1025
Right 1050531779 9:6596931-6596953 TACACAGAAGTGTTCACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050531777 Original CRISPR TGTAATGTTTTCAGTTCTTT TGG (reversed) Intronic
901043017 1:6377064-6377086 TTTGATGTTGTCAGTACTTTGGG - Intronic
903290020 1:22304893-22304915 TTCAATGATTTCAATTCTTTTGG - Intergenic
903753785 1:25646900-25646922 GGACATGTTTTCAGTTCTTTAGG + Intronic
904220815 1:28967319-28967341 TTTTATGATTTCAGTTCTTCAGG + Intronic
904367807 1:30027254-30027276 TCAACTGCTTTCAGTTCTTTTGG - Intergenic
904651854 1:32012041-32012063 TGTTTTGTTTTCATTTCTGTGGG + Intergenic
904880439 1:33692612-33692634 TGTACTGTTTGCAGGACTTTGGG - Intronic
904995075 1:34625453-34625475 TATAATGTTTTGACATCTTTGGG + Intergenic
905112620 1:35607684-35607706 TATAATGATTTCCTTTCTTTTGG - Intronic
905347464 1:37320659-37320681 TGTATTGATTTCCTTTCTTTTGG - Intergenic
907345315 1:53773280-53773302 ATTTTTGTTTTCAGTTCTTTTGG - Intronic
907456204 1:54577644-54577666 TGTACTTGTTTTAGTTCTTTTGG + Intronic
907611849 1:55879196-55879218 TGTTATATTCTCACTTCTTTAGG - Intergenic
907763384 1:57384415-57384437 GATACTGCTTTCAGTTCTTTTGG - Intronic
907907438 1:58796524-58796546 TTTCATGATTTCAGTTCCTTGGG - Intergenic
907963273 1:59303584-59303606 AGTAGTGATTTCATTTCTTTTGG + Intronic
908290390 1:62660642-62660664 TTTACTGTTTTCAGTTCTTTTGG - Intronic
908307795 1:62841404-62841426 TGTAATTTTTAAAGTTCTTTAGG - Intronic
908935032 1:69364820-69364842 TGAAAGGTTTTGAGGTCTTTAGG + Intergenic
909038292 1:70620636-70620658 GGAGATGTTTTCAGTTCATTTGG + Intergenic
909612865 1:77571449-77571471 TATCCTGCTTTCAGTTCTTTTGG - Intronic
909654671 1:78018162-78018184 TGTAATGTTCACACTTCTGTAGG - Intronic
909883472 1:80910340-80910362 AGTAATTTTTGCAGCTCTTTTGG + Intergenic
910412392 1:86960924-86960946 CTTAAAGTTTTCAGTTCATTTGG - Intronic
910464564 1:87484039-87484061 TGTACTGATTTCCTTTCTTTTGG + Intergenic
910722243 1:90299430-90299452 TGATATGTTTTTAGTGCTTTTGG + Intergenic
910859177 1:91726723-91726745 TTTTATGTTTTCAGTATTTTGGG - Intronic
911067998 1:93809335-93809357 TGTTTTGTTTTGAGTTTTTTTGG - Intronic
911328596 1:96498756-96498778 TGTAATGTCTTCATTTCATCCGG + Intergenic
911470369 1:98310643-98310665 TGTACTGATTTCCTTTCTTTGGG - Intergenic
911508858 1:98786837-98786859 TGTTATGATTTCAGTTCTTTTGG - Intergenic
912026266 1:105178221-105178243 TATAATGATTTCTTTTCTTTTGG - Intergenic
912059731 1:105652409-105652431 TGTGATGATTTCAGTTCTTGAGG + Intergenic
912081113 1:105937327-105937349 TATCCTGATTTCAGTTCTTTTGG + Intergenic
912117936 1:106430424-106430446 TGTGATTTTTTAATTTCTTTTGG + Intergenic
912148292 1:106821918-106821940 TGTAATGATTTCCTTTCCTTTGG + Intergenic
912565000 1:110581040-110581062 TGTAAAGTTTTAAGGTTTTTGGG + Intergenic
912985193 1:114420879-114420901 TGTAACAATTTCAGTTCTTTTGG - Intronic
913008880 1:114663135-114663157 TATCATGTTTTCTTTTCTTTAGG + Intronic
913084011 1:115417840-115417862 TGAAATGTTTTCTGTTTTCTTGG - Intergenic
913720115 1:121584529-121584551 TGTTATGATTTCTGTTCTTTTGG + Intergenic
914216281 1:145632731-145632753 TTTACTGATTTCAGATCTTTTGG + Intronic
914359337 1:146918748-146918770 TGTACTGATTTCCTTTCTTTTGG + Intergenic
914429683 1:147609708-147609730 TGTAATGTTTTGAGTTTCTTTGG + Intronic
914468852 1:147955390-147955412 TTTACTGATTTCAGATCTTTTGG + Intronic
914494412 1:148181127-148181149 TGTACTGATTTCCTTTCTTTTGG - Intergenic
914966445 1:152262618-152262640 TGTTATAATTTCTGTTCTTTTGG + Intergenic
915114952 1:153591729-153591751 TGGGCTGTTTTCAGTTTTTTGGG - Intergenic
915177915 1:154032187-154032209 TATAATGATTTCCTTTCTTTTGG + Intronic
915705533 1:157839913-157839935 AGTAATATTTTCAGTTTTGTGGG + Intronic
915917140 1:159947019-159947041 TGTAAAGGTTTTAGTGCTTTTGG + Intergenic
916368340 1:164060113-164060135 TGTCATGCTTTCATTTTTTTCGG - Intergenic
917269899 1:173261110-173261132 TGTCATAATTTCAGTTCTTCTGG - Intergenic
917474280 1:175354875-175354897 TGAAATGTATTCTGTGCTTTTGG + Intronic
918005099 1:180534575-180534597 TGTAATGGTTTGAGTTCCTGAGG + Intergenic
918028536 1:180779015-180779037 TGAGCTGCTTTCAGTTCTTTAGG + Intronic
918096323 1:181337843-181337865 GGTACTGATTTCATTTCTTTTGG + Intergenic
918580250 1:186118509-186118531 ACAAATGTTTTCATTTCTTTTGG - Intronic
918637002 1:186788853-186788875 TGTAATGTCTTTAGTTCTTTTGG - Intergenic
918769642 1:188539081-188539103 TGTACTGATTTCCTTTCTTTTGG + Intergenic
918944340 1:191041978-191042000 TGTTAAGTTTTCAGATCTCTAGG - Intergenic
919325682 1:196103538-196103560 TGTAATGATTCCCTTTCTTTTGG - Intergenic
919370593 1:196720848-196720870 AGTTCTGTTTTTAGTTCTTTGGG + Intronic
919584546 1:199419873-199419895 TGTAATGATTTATTTTCTTTTGG - Intergenic
920023465 1:202974047-202974069 TGTAATGTTTCCATTTCTTTAGG + Intergenic
920283770 1:204864347-204864369 ATTCCTGTTTTCAGTTCTTTTGG + Intronic
920531980 1:206709075-206709097 TGTAATGTTTTCATTTCTCCTGG + Intronic
920631541 1:207657991-207658013 TGTATACTTTTCATTTCTTTGGG - Intronic
920739935 1:208570983-208571005 TGTCTTGCTTTCAATTCTTTTGG + Intergenic
920905029 1:210155936-210155958 TCTAATGTTTTCTGCACTTTTGG + Intronic
921163187 1:212487324-212487346 TGGAATGTTGTCAGTGCTTTAGG - Intergenic
921493042 1:215802764-215802786 TCTCCTGTTTTCAATTCTTTTGG - Intronic
921494419 1:215821072-215821094 TATATTGTTTTCCTTTCTTTTGG + Intronic
921540813 1:216412678-216412700 ATATATGTTTTCAGTTCTTTTGG + Intronic
921935299 1:220790162-220790184 GTTCCTGTTTTCAGTTCTTTGGG + Intronic
922027850 1:221768565-221768587 AGTTCTGTTTTCAGTTCTTTGGG + Intergenic
922281856 1:224132897-224132919 CATTATGTTTTCATTTCTTTTGG - Intronic
922893980 1:229086523-229086545 TATCCTGTTTTCAATTCTTTTGG - Intergenic
923066684 1:230524635-230524657 TGTTATGATTTCCATTCTTTTGG + Intergenic
923228524 1:231961923-231961945 AGTTCTGTTTTAAGTTCTTTGGG + Intronic
923481397 1:234388432-234388454 GGTTTTGTTTTCAGTTCATTCGG - Intergenic
923645580 1:235817321-235817343 AGTTCTGTTTTAAGTTCTTTGGG - Intronic
924364731 1:243279870-243279892 TGTAATGTTTTCACTTGGTTCGG + Intronic
924955019 1:248917743-248917765 TTCATTTTTTTCAGTTCTTTGGG - Exonic
1063049307 10:2429491-2429513 ACTTATGTTTTCATTTCTTTGGG - Intergenic
1063556864 10:7088747-7088769 TCTAGTGTTTTCAGCTCTTCTGG - Intergenic
1063749463 10:8926347-8926369 TGTACTGATTTCCTTTCTTTTGG + Intergenic
1064481197 10:15742567-15742589 TGGAATGATTTCTGTTCCTTTGG + Intergenic
1064503004 10:15995005-15995027 TGATATCCTTTCAGTTCTTTTGG + Intergenic
1064776077 10:18778695-18778717 TGTCATTTTTTCAGTTATTTTGG + Intergenic
1064877682 10:20013684-20013706 TGAATTGTTTTCAGTTCTTTGGG - Intronic
1064965713 10:21013323-21013345 TGTAATGGTTAAAGTTCATTGGG - Intronic
1064969105 10:21045875-21045897 CATACTGTTTTCAGTTCCTTTGG - Intronic
1065261658 10:23929848-23929870 AGTTCTGTTTTAAGTTCTTTGGG + Intronic
1065467137 10:26036394-26036416 AGTGATGTTTTCATTTCTTTTGG + Intronic
1065546840 10:26830245-26830267 AGGTATGTTTTCATTTCTTTTGG + Intronic
1066260929 10:33729039-33729061 TTTTATGTTTTCAGGTTTTTTGG - Intergenic
1066279449 10:33901100-33901122 GGTAATGTTTTCAGTCTTTAGGG - Intergenic
1066353752 10:34662411-34662433 TGTACTGATTTCCTTTCTTTAGG - Intronic
1066565151 10:36714356-36714378 TATAATTTTTTCTTTTCTTTTGG - Intergenic
1066690351 10:38020819-38020841 TGTACTGATTTCTTTTCTTTTGG + Intronic
1067176173 10:43947891-43947913 TTGCATGTTTTCATTTCTTTTGG + Intergenic
1067393557 10:45888752-45888774 ACTAAACTTTTCAGTTCTTTAGG - Intergenic
1067801563 10:49362728-49362750 TGTAAAGGTTTCACTTCTTCTGG + Intergenic
1067857773 10:49811259-49811281 TGTGAAGTTTTCAATTCATTTGG + Intergenic
1067861881 10:49857895-49857917 ACTAAACTTTTCAGTTCTTTAGG - Intronic
1068634055 10:59328867-59328889 TCTTATATTTTCAGTTCTTAAGG + Intronic
1068780088 10:60910536-60910558 TAGAATGTTTTAAGTTATTTTGG - Intronic
1068901045 10:62269135-62269157 AGTAATGTTATTGGTTCTTTAGG - Intergenic
1068926312 10:62542919-62542941 TGTAGTGATTTCATTTCCTTTGG - Intronic
1069108876 10:64418883-64418905 TCTCATGTTTTTATTTCTTTTGG - Intergenic
1069157057 10:65042644-65042666 TATAATGGTTTCTTTTCTTTGGG + Intergenic
1069190851 10:65487252-65487274 TGGAATTCTTTCAGGTCTTTGGG - Intergenic
1069210017 10:65745054-65745076 TGTGATGTTTTTATTTGTTTGGG - Intergenic
1069256816 10:66343232-66343254 TATAATGATTTAATTTCTTTTGG - Intronic
1069488737 10:68843385-68843407 GGACATGTTTTCATTTCTTTTGG + Intronic
1069972670 10:72186458-72186480 TGTGGGATTTTCAGTTCTTTTGG - Intronic
1070200858 10:74204671-74204693 TTTAATGATTTTAGTTCTTTTGG + Intronic
1070314666 10:75298682-75298704 GGCCATGTTTTCAGTTCTTTTGG + Intergenic
1070443557 10:76470404-76470426 GTTCTTGTTTTCAGTTCTTTGGG - Intronic
1070450295 10:76551108-76551130 TATGATGTTTACAGCTCTTTAGG + Intronic
1070455215 10:76608024-76608046 TATACTGTTTTCCTTTCTTTTGG - Intergenic
1071341466 10:84652748-84652770 TATAATGATTTCTTTTCTTTTGG + Intergenic
1071367957 10:84920024-84920046 TGAAATGATTTCTATTCTTTGGG - Intergenic
1071468183 10:85959862-85959884 TATATTTTTTTCATTTCTTTTGG + Intronic
1071801375 10:89065715-89065737 TGTAATATATTCAATTCTTTTGG - Intergenic
1072073593 10:91945768-91945790 GTTACTGCTTTCAGTTCTTTGGG + Intronic
1072078508 10:92003733-92003755 TGTACTGATTTCATTTCCTTTGG + Intronic
1072144014 10:92617504-92617526 TGATGTGTTTTCATTTCTTTTGG + Intronic
1072259075 10:93650076-93650098 TGAAATGTTTTCAGTTGCTATGG + Intronic
1072375088 10:94806386-94806408 TGTGCTGCTTTCAATTCTTTTGG + Intronic
1072389207 10:94965793-94965815 TGTGCTGCTTTCAATTCTTTTGG + Intronic
1072410942 10:95201642-95201664 TATAATGATTTCTTTTCTTTTGG + Intronic
1072751349 10:97981882-97981904 TGTATTGTTTTCATGTCTATTGG + Intronic
1072824662 10:98594787-98594809 TGTATTGATTTCATTTCCTTTGG + Intronic
1073358320 10:102875054-102875076 TGTCATGATTTCAGATCTTTGGG + Intronic
1073390347 10:103171115-103171137 TTTAATGTTTTCACTTTTTCAGG + Intronic
1073651462 10:105364006-105364028 TGTACTGATTTCATTTCCTTTGG + Intergenic
1073728565 10:106264513-106264535 TGTAAAGGTTTCAATTCATTTGG - Intergenic
1073931655 10:108583850-108583872 TCAAATGCTTTCAATTCTTTGGG + Intergenic
1074004687 10:109408915-109408937 GGGTATGTTTTCATTTCTTTTGG - Intergenic
1074425878 10:113350874-113350896 TGAAATGGTTTCCCTTCTTTTGG + Intergenic
1074555154 10:114482488-114482510 TGTTATCTTTTAAGTACTTTTGG - Intronic
1074582370 10:114731910-114731932 CATAATGTTTTCAGTCCTCTTGG + Intergenic
1074812374 10:117118556-117118578 TGTATTGATTTCCTTTCTTTTGG - Intronic
1074812471 10:117119672-117119694 TGTACTGATTTCTTTTCTTTTGG - Intronic
1075169271 10:120098035-120098057 TTTAATGTTTTTACTTCTTTTGG + Intergenic
1075514529 10:123098436-123098458 TGTAATGTTGGCATTTTTTTAGG + Intergenic
1075753953 10:124795985-124796007 TGTACTGATTTCCTTTCTTTGGG + Intergenic
1076111034 10:127859995-127860017 TGAAATGTTTTCAGTTCTCTTGG + Intergenic
1076341692 10:129753314-129753336 TGTCCTGTTTGCAGTTTTTTGGG + Intronic
1077148687 11:1058100-1058122 GGTTCTGTTTTCAGTTTTTTGGG + Intergenic
1078165337 11:8878281-8878303 ACAATTGTTTTCAGTTCTTTTGG - Intronic
1078286990 11:9966914-9966936 AGATATGTTTTCAGTTCTCTTGG - Intronic
1078311271 11:10245652-10245674 TATCTTGATTTCAGTTCTTTTGG - Intronic
1078511729 11:11989207-11989229 TCAAATGCTTTCACTTCTTTTGG - Intronic
1078677048 11:13430531-13430553 GATAATGTCTTCATTTCTTTTGG - Intronic
1079595419 11:22239084-22239106 TGTAATATTTTAAGTTCTTTGGG + Intronic
1079680855 11:23295944-23295966 GTTAGTGTTTTCAGTTATTTAGG - Intergenic
1079715663 11:23740457-23740479 TATAATGATTTCTTTTCTTTTGG + Intergenic
1080244734 11:30167109-30167131 TGTAATAGTTGCAGTGCTTTGGG + Intergenic
1080264854 11:30389842-30389864 TGTTATGTTATCTGGTCTTTAGG - Intronic
1080316099 11:30950353-30950375 TGTATTGGTTTCCTTTCTTTTGG - Intronic
1080375639 11:31707064-31707086 TGTAATGATTTCCTTTCCTTTGG + Intronic
1080473359 11:32567639-32567661 TTTTGTGTTTTCAGTTCATTTGG + Intergenic
1081003997 11:37710942-37710964 AGTAATATTTTCCTTTCTTTTGG + Intergenic
1081823774 11:46026176-46026198 TTTAAAATTTTCAGTCCTTTGGG + Intronic
1082872385 11:57955313-57955335 CGTAATTTTTTCAGTTGTTTTGG + Intergenic
1082896494 11:58196071-58196093 TATATTGGTTTCAATTCTTTTGG + Intergenic
1083010261 11:59390433-59390455 AGTTCTGTTTTCAGCTCTTTGGG - Intergenic
1083582662 11:63835055-63835077 TGTTTTGTTTTCAGTTGTTCAGG + Intergenic
1084135659 11:67178885-67178907 ACGTATGTTTTCAGTTCTTTGGG + Intronic
1084382592 11:68822604-68822626 GGACATGTTTTCAGTTCTCTTGG - Intronic
1084986017 11:72872776-72872798 GGACATGTTTTCACTTCTTTTGG + Intronic
1085093737 11:73741489-73741511 GGACATGTTTTCAGCTCTTTTGG - Intronic
1085708087 11:78804836-78804858 TGTAGTGTTTAGGGTTCTTTGGG - Intronic
1085743701 11:79097291-79097313 GGTTATGTTTTCTATTCTTTGGG + Intronic
1085842380 11:80027293-80027315 TGTATTGATTTCTTTTCTTTTGG - Intergenic
1085916783 11:80899499-80899521 AGTTATGTTTTCAGTTCCCTTGG + Intergenic
1086154048 11:83646430-83646452 TCTAATTTCTTCTGTTCTTTTGG + Intronic
1086524121 11:87704462-87704484 TGTACTGATTTCCTTTCTTTGGG + Intergenic
1086623990 11:88923206-88923228 TGTACTGTTTTCCTTCCTTTTGG - Intronic
1086748833 11:90464395-90464417 TATAATGATTTCCTTTCTTTTGG - Intergenic
1086832987 11:91588259-91588281 TGTATTGATTTCTGTTCCTTGGG + Intergenic
1087399052 11:97641068-97641090 TGTTAGGTTTTCTGTTCTTGTGG - Intergenic
1087497003 11:98904324-98904346 TGTTATGTTTTCACATGTTTTGG + Intergenic
1087678750 11:101193813-101193835 TGTAGACTTTTCACTTCTTTAGG + Intergenic
1087960018 11:104337199-104337221 TTTTATTTTTTCTGTTCTTTAGG + Intergenic
1088845672 11:113663999-113664021 TGTATTCTTTTGACTTCTTTAGG - Intergenic
1089369303 11:117943072-117943094 GCTTATATTTTCAGTTCTTTTGG + Intergenic
1090101940 11:123806665-123806687 TCTAATCTTTTCTATTCTTTTGG + Intergenic
1090388647 11:126372913-126372935 TATTCTGGTTTCAGTTCTTTGGG + Intronic
1091974414 12:4813027-4813049 TGTACTGTTCTGAGATCTTTTGG + Exonic
1092267517 12:6994153-6994175 TTTTATGTTTTCAATTCTCTTGG + Intronic
1092853337 12:12650317-12650339 ATTAATGTTTTCAGATCATTAGG + Intergenic
1093104074 12:15065397-15065419 TGTGATGTTCTCAGTGGTTTAGG + Intergenic
1093739853 12:22672441-22672463 TTTGATGTTTCCAGTTATTTTGG + Intronic
1093916630 12:24809631-24809653 TGTAATGAGTTCCTTTCTTTTGG + Intergenic
1094146426 12:27233275-27233297 TATAATGATTTCCTTTCTTTTGG + Intergenic
1094223406 12:28019293-28019315 TGTAAGGGTGTTAGTTCTTTGGG + Intergenic
1094464851 12:30741810-30741832 GGACATGTTTTCATTTCTTTTGG - Intronic
1094600002 12:31900419-31900441 GGACATGTTTTCATTTCTTTTGG + Intergenic
1094765355 12:33588343-33588365 TGTCATTTTTTCATTTCTTCTGG - Intergenic
1095215907 12:39547334-39547356 GACCATGTTTTCAGTTCTTTTGG - Intergenic
1095298244 12:40551489-40551511 GGTTCTGTTTTAAGTTCTTTGGG + Intronic
1095594306 12:43941229-43941251 AGTGATGTTTTCACTTCTGTTGG + Intronic
1095671240 12:44862020-44862042 TTATATGTTTTCATTTCTTTGGG - Intronic
1095988888 12:48020136-48020158 TGTATAGTAATCAGTTCTTTTGG + Exonic
1097258939 12:57702560-57702582 AGTCCTGTTTTCAATTCTTTTGG + Intronic
1097799025 12:63892234-63892256 TGTTCTGTTTTCAGTTTTTCTGG + Intronic
1097813754 12:64048485-64048507 TGTAATGATTTTCTTTCTTTTGG + Intronic
1097823745 12:64153814-64153836 TCTTCTGTTTTCAATTCTTTTGG - Exonic
1097947477 12:65388052-65388074 TGTAATCTTTCTATTTCTTTAGG + Intronic
1098162996 12:67665322-67665344 TGAATTGTTTTCAATTGTTTTGG + Exonic
1098563416 12:71903465-71903487 AGTTCTGTTTTAAGTTCTTTGGG - Intronic
1098691524 12:73495268-73495290 TATATTGATTTCAGTTCCTTTGG - Intergenic
1098970184 12:76846349-76846371 TGTGATTTATTTAGTTCTTTGGG + Intronic
1099090425 12:78300055-78300077 TCTTATGTTTTCAGTTATATTGG + Intergenic
1099338051 12:81390269-81390291 ACAAATGTTTTCAGTTCTCTTGG + Intronic
1099362646 12:81724812-81724834 TATAATGATTTCTGTTCCTTTGG + Intronic
1099424240 12:82503176-82503198 TGTACTGATTTCATTTCCTTTGG + Intergenic
1099602992 12:84765050-84765072 TGTAATGATTTCTTTTCCTTTGG + Intergenic
1099625214 12:85064020-85064042 TATACTGATTTCATTTCTTTCGG + Intronic
1099900415 12:88704155-88704177 TGTAATGTTTTCTTTTCCTTTGG + Intergenic
1100483792 12:95005183-95005205 GATCCTGTTTTCAGTTCTTTTGG + Intergenic
1101076594 12:101135691-101135713 GCATATGTTTTCAGTTCTTTGGG - Intergenic
1101081270 12:101187515-101187537 TGGTTTGTTTTCACTTCTTTAGG - Exonic
1101155460 12:101923648-101923670 TGTAAACATTTCAGTTGTTTCGG + Intronic
1101780816 12:107833664-107833686 TGTAAGGATTTCAATTGTTTTGG - Intergenic
1102667492 12:114587893-114587915 AGTCCTGCTTTCAGTTCTTTTGG - Intergenic
1102765013 12:115424961-115424983 TGTAATAATTTCTTTTCTTTCGG - Intergenic
1102781429 12:115569076-115569098 TGTCAAGTTTTCAGAACTTTTGG + Intergenic
1103125369 12:118417392-118417414 TGTATTTTTTACAGTTTTTTGGG + Exonic
1103491354 12:121323246-121323268 TGAAATGTTTTCATGTTTTTGGG + Intronic
1104102633 12:125628133-125628155 AGTAATGATTTCCTTTCTTTTGG + Intronic
1105047717 12:133019725-133019747 TGTACTGATTTCCTTTCTTTTGG - Exonic
1105455014 13:20532344-20532366 TGAAATGTGTTCAAATCTTTTGG - Intergenic
1105490142 13:20880552-20880574 AGCATTGCTTTCAGTTCTTTTGG - Intronic
1105608434 13:21946727-21946749 TGTAATGTTTCAATGTCTTTAGG - Intergenic
1105732570 13:23233071-23233093 TGCCCTGTTTTCAATTCTTTCGG - Intronic
1105838975 13:24236898-24236920 AGTCCTGTTTTCAATTCTTTTGG - Intronic
1106333099 13:28757464-28757486 GATCCTGTTTTCAGTTCTTTTGG + Intergenic
1106491366 13:30226280-30226302 ATGAATGTTTTCAATTCTTTTGG - Intronic
1106842743 13:33702574-33702596 TGTAGTGATTTCCTTTCTTTTGG + Intergenic
1106855692 13:33849404-33849426 TGTAGTGTTTGCAGTTTTTCTGG + Intronic
1107042657 13:35966294-35966316 GATATTGCTTTCAGTTCTTTTGG - Intronic
1107085762 13:36426506-36426528 TGTATTGATTTCCTTTCTTTTGG - Intergenic
1107155423 13:37161321-37161343 GTTTCTGTTTTCAGTTCTTTTGG + Intergenic
1107283982 13:38768754-38768776 TTGAATGTTTTCACTGCTTTTGG + Intronic
1107608615 13:42089366-42089388 TTTAATGTTTTCATTTTTTATGG + Intronic
1108229799 13:48324694-48324716 TATACTGTTTTTATTTCTTTTGG + Intronic
1108231058 13:48341394-48341416 TATAATGTTTTCATTTCTCTTGG + Intronic
1108444368 13:50492629-50492651 TGAATTGTTTTTAATTCTTTAGG + Intronic
1108538855 13:51416705-51416727 AGACATGTTTTCATTTCTTTAGG + Intronic
1108627293 13:52243222-52243244 TGTAATATTTTCATTTTATTGGG - Intergenic
1108658775 13:52563242-52563264 TGTAATATTTTCATTTTATTGGG + Intergenic
1108939803 13:55938761-55938783 TGTAATGTGATGAGCTCTTTGGG - Intergenic
1109034117 13:57232698-57232720 TGTTATGATTTCCATTCTTTTGG - Intergenic
1109409921 13:61949579-61949601 TATAATGATTTCACTTCCTTTGG - Intergenic
1109433262 13:62264332-62264354 TATAATGATTTCATTACTTTTGG - Intergenic
1109590725 13:64477232-64477254 GATAATTTTTTCAATTCTTTTGG - Intergenic
1109869711 13:68318102-68318124 TGAAATGTCGTCATTTCTTTGGG + Intergenic
1109888252 13:68572119-68572141 TGTAATTTTTTCAGTTTTACTGG + Intergenic
1110149631 13:72235148-72235170 TGAGTTGTTTTAAGTTCTTTGGG + Intergenic
1110345356 13:74441256-74441278 TGCAATATTTTCATTTTTTTTGG + Intergenic
1110910878 13:80961346-80961368 TGTATTGATTTCCTTTCTTTTGG + Intergenic
1111204060 13:84980595-84980617 TGTATTGATTTCCGTTCTTTTGG + Intergenic
1111338510 13:86853074-86853096 TATAATGTTTTGTATTCTTTTGG - Intergenic
1111381902 13:87466359-87466381 TATGATGTTTACAGTTGTTTAGG + Intergenic
1111448923 13:88389347-88389369 TGTAATGATTTTTTTTCTTTTGG - Intergenic
1111838232 13:93415757-93415779 TTTAATTTTTTTAGGTCTTTAGG + Intronic
1111872837 13:93855512-93855534 GGATATGTTTTCAGTTCCTTTGG + Intronic
1111933998 13:94540805-94540827 TATACTGATTTCCGTTCTTTTGG - Intergenic
1111957884 13:94778224-94778246 TTTTATGTTTGGAGTTCTTTTGG + Intergenic
1112068666 13:95823089-95823111 TATAGTGTTTACAGTTCCTTTGG + Intronic
1112085163 13:96023429-96023451 TGTAATTTTTATAGTTATTTGGG - Intronic
1112107356 13:96255360-96255382 GATAATGTTTTCACTTCTGTGGG - Intronic
1112136947 13:96590170-96590192 TGTACTGATTTCCTTTCTTTTGG + Intronic
1112198166 13:97246428-97246450 TGTAAAATTTTCACTTTTTTAGG - Intronic
1112543058 13:100336289-100336311 TGTAGTGTTTTCTGTTTTTTGGG - Intronic
1112971201 13:105265400-105265422 CCTATTGTTTTTAGTTCTTTTGG - Intergenic
1112988276 13:105479256-105479278 TGTAATGTTTGTTGCTCTTTCGG - Intronic
1113025217 13:105933321-105933343 TGAAATGTTTAATGTTCTTTGGG + Intergenic
1114210938 14:20614126-20614148 TGTAAGAATTTCAGATCTTTGGG + Intergenic
1114697111 14:24636269-24636291 CAATATGTTTTCAGTTCTTTTGG + Intergenic
1114805900 14:25836375-25836397 TGTTTTGATTTCAGTGCTTTAGG - Intergenic
1115021081 14:28682561-28682583 TGGAATGTTTTATGTTCCTTTGG + Intergenic
1115101302 14:29704054-29704076 TGTATTGTTTACATTTCTTGTGG - Intronic
1115219619 14:31046517-31046539 AGAAATGTTTTCATTTCTCTTGG + Intronic
1115222977 14:31075511-31075533 TGTATTGATTTCCTTTCTTTTGG + Intronic
1115383377 14:32766341-32766363 TCATATGTTTTCAGTTCTCTTGG + Intronic
1115723005 14:36183566-36183588 AGAAATGTTTTCATTTCTCTTGG + Intergenic
1115838741 14:37441693-37441715 TGTTTTGTTTTCTGTTTTTTGGG + Intronic
1116219522 14:42065003-42065025 TGTTTTGTTGTCACTTCTTTTGG + Intergenic
1116257697 14:42578018-42578040 TGTACTGATTTCTTTTCTTTGGG - Intergenic
1116668416 14:47809122-47809144 TATACTGATTTCATTTCTTTTGG + Intergenic
1117268126 14:54112264-54112286 TGTACTGATTTCCTTTCTTTTGG - Intergenic
1117482279 14:56159588-56159610 TGTGATATTTTCTCTTCTTTTGG + Intronic
1117503969 14:56382330-56382352 TATACTGTTTTCCCTTCTTTTGG + Intergenic
1117616813 14:57542464-57542486 TGTTATGATTTCCGTTCTTTTGG + Intergenic
1117843348 14:59884051-59884073 TGGCATGTTTTCATTTCTCTTGG + Intergenic
1117870264 14:60193282-60193304 TATAATGATTTCCTTTCTTTTGG + Intergenic
1118032586 14:61832942-61832964 TCTATTGTTTTCACTTCTTAAGG + Intergenic
1118225208 14:63892431-63892453 TGTAATGTTTTTTTTTCCTTGGG - Intronic
1118298574 14:64593618-64593640 TGTAATGTTTTCATTTCTCTTGG - Intergenic
1119314813 14:73684282-73684304 CATACTGTTTTCATTTCTTTTGG + Intronic
1120374604 14:83686778-83686800 TATCTTGCTTTCAGTTCTTTTGG - Intergenic
1120448406 14:84632376-84632398 AAAAATGTTTTCAGTTCATTTGG + Intergenic
1120496365 14:85242047-85242069 TGAACTGTTTTGACTTCTTTAGG + Intergenic
1120625852 14:86825551-86825573 TGTATTTTTTTCAGTTATTGGGG + Intergenic
1120644476 14:87056957-87056979 AGTTATGTTTTCAGTTCTGATGG + Intergenic
1120748330 14:88173938-88173960 TATAATGATTTCTTTTCTTTGGG - Intergenic
1121724154 14:96134136-96134158 TGAATTTATTTCAGTTCTTTTGG - Intergenic
1121805144 14:96812299-96812321 GGTAATTCTTTAAGTTCTTTAGG + Intronic
1123485465 15:20732043-20732065 TGTTCTTTTTTCAGTTATTTTGG + Intergenic
1123541951 15:21301091-21301113 TGTTCTTTTTTCAGTTATTTTGG + Intergenic
1123683427 15:22780365-22780387 AGTAATGATTTCATTTCCTTTGG + Intronic
1123802081 15:23831750-23831772 GGTTATGTTTTCATTTCTCTTGG + Intergenic
1123911034 15:24967201-24967223 TCTTGTGTTTTTAGTTCTTTTGG + Intronic
1124174263 15:27407468-27407490 AGACATGTTTTCAGTTCCTTTGG - Intronic
1124246508 15:28075200-28075222 TATTATTTTTTCATTTCTTTTGG - Intronic
1124335630 15:28854772-28854794 AGTAATGATTTCATTTCCTTTGG + Intergenic
1124648777 15:31459360-31459382 TGTAATGTGTACAGTTCTATGGG + Intergenic
1124659581 15:31535537-31535559 TCTTATGTTTTCATTTCTCTTGG - Intronic
1125269916 15:37927525-37927547 TATATTGATTTCAGTTCCTTTGG - Intronic
1125547697 15:40519152-40519174 TGTATTGTATTCCTTTCTTTGGG - Intergenic
1125554793 15:40575148-40575170 AAATATGTTTTCAGTTCTTTTGG + Intergenic
1125621352 15:41065531-41065553 TTTACTGTTTTCACTTCTTTTGG - Intronic
1125736151 15:41927307-41927329 AGTCCTGATTTCAGTTCTTTTGG - Intronic
1125783006 15:42287975-42287997 TTTAATGTATTCAGTTATTTGGG + Intronic
1125856724 15:42957026-42957048 CATAAAGTTTTCATTTCTTTTGG - Intronic
1126270116 15:46806195-46806217 AGTTCTGTTTTTAGTTCTTTGGG - Intergenic
1126708884 15:51434640-51434662 TATACTGATTTCATTTCTTTTGG + Intergenic
1126869549 15:52973024-52973046 TGTAATATTTTCAGGTTTTGGGG + Intergenic
1127024158 15:54784119-54784141 TGTTTTGATTTCAGTTCTTTTGG - Intergenic
1127048875 15:55058732-55058754 GTTCCTGTTTTCAGTTCTTTTGG + Intergenic
1127823381 15:62681063-62681085 TGTAATGTCTTCTTTTCCTTTGG + Intronic
1128010433 15:64290212-64290234 TGTAATGATTTCTTTTCCTTTGG - Intronic
1128436007 15:67648876-67648898 GTCAGTGTTTTCAGTTCTTTTGG + Intronic
1128620502 15:69145441-69145463 TTTAATGTTTCCAGTCCCTTGGG - Intergenic
1128786426 15:70400743-70400765 AGTAATATTTTTCGTTCTTTGGG - Intergenic
1128909531 15:71499966-71499988 GGTCTTGTTTTCAGTTCTTTTGG + Intronic
1128917813 15:71581044-71581066 GGTAATGATTTCATTTCCTTTGG + Intronic
1128966523 15:72063810-72063832 TATACTGATTTCCGTTCTTTTGG - Intronic
1129075792 15:72994928-72994950 AGAACTGTTTTCAGTTCGTTAGG - Intergenic
1129587277 15:76881061-76881083 AGAACTGTTTTCAGTTATTTCGG - Intronic
1129647789 15:77453581-77453603 GGACATGTTTTCAGTTCTCTTGG - Intronic
1130004155 15:80078603-80078625 AGTTGTGTTTTAAGTTCTTTGGG + Intronic
1130252861 15:82312117-82312139 TGAAATGTTTTTATTTCCTTTGG + Intergenic
1130711542 15:86286845-86286867 TGTACTGATTTCAGTTCCTTTGG + Intronic
1131103145 15:89709791-89709813 ACAAATGTTTTCATTTCTTTTGG - Intronic
1131573283 15:93560949-93560971 TGTAATATTTTTAATTCTCTAGG + Intergenic
1132130257 15:99270756-99270778 GGACCTGTTTTCAGTTCTTTTGG + Intronic
1202950270 15_KI270727v1_random:28233-28255 TGTTCTTTTTTCAGTTATTTTGG + Intergenic
1132924206 16:2419448-2419470 TGTAGGTTTTTCAGTTCTTTTGG - Intergenic
1133238248 16:4399144-4399166 TGGCCTGCTTTCAGTTCTTTTGG - Intronic
1133244115 16:4435810-4435832 AGACATGTTTTCAGTTCTCTTGG + Intronic
1133475750 16:6120260-6120282 GTACATGTTTTCAGTTCTTTTGG + Intronic
1133541927 16:6764349-6764371 TGAAATATTTTCAGTCCTTATGG + Intronic
1135414476 16:22258243-22258265 TGGAATGTGGTCAGTGCTTTAGG + Intronic
1135471067 16:22731271-22731293 TGTAATGATTTCTTTTCCTTTGG + Intergenic
1135582163 16:23637926-23637948 CTTAATCTTTTCAGCTCTTTGGG + Exonic
1137030044 16:35514348-35514370 TGTAATATTTTAATCTCTTTTGG - Intergenic
1137265021 16:46861729-46861751 TGTTATGTTTTGCCTTCTTTGGG + Intergenic
1137281662 16:46982118-46982140 CATACTGATTTCAGTTCTTTTGG + Intergenic
1137630798 16:49942853-49942875 TATAATGATTTCCTTTCTTTTGG - Intergenic
1137874730 16:51985109-51985131 TACACTGATTTCAGTTCTTTTGG - Intergenic
1138065790 16:53939977-53939999 TGACATATTTTCAGTTCTCTTGG + Intronic
1139564991 16:67768964-67768986 TGTAATATTTGCTGTTCCTTGGG - Intronic
1139619888 16:68130136-68130158 TCTACTGATTTCATTTCTTTTGG + Intronic
1140272652 16:73480581-73480603 TGGAATGTTTGCAGTGCTGTTGG + Intergenic
1140490523 16:75331800-75331822 AGAGATGTTTTCATTTCTTTTGG + Intronic
1140646335 16:77035027-77035049 TGTACTGATTTCTTTTCTTTTGG + Intergenic
1140856255 16:78980382-78980404 TGGAATGGTTTTAGTTCTCTTGG + Intronic
1141153571 16:81581610-81581632 GTCCATGTTTTCAGTTCTTTGGG + Intronic
1141236391 16:82221784-82221806 TATAATGATTTCCTTTCTTTTGG + Intergenic
1141849261 16:86633305-86633327 GTTCATGTTTTCAGTTCTTTTGG + Intergenic
1142782830 17:2194686-2194708 TGTTTTGTTTTCTTTTCTTTTGG - Intronic
1142902641 17:3021967-3021989 TGTACTGATTTCCTTTCTTTTGG + Intronic
1143056580 17:4167141-4167163 TGTAAAGCTTTCAGTTGTTAAGG + Exonic
1143087965 17:4430822-4430844 TGGCCTGTTTTCAGTTCTTTTGG + Intergenic
1143440530 17:6969526-6969548 TGGACTGTTTTCACTTCTCTTGG - Intronic
1143897746 17:10149604-10149626 GGACATGTTTTCAGTTCTCTTGG - Intronic
1144410857 17:15000325-15000347 ATACATGTTTTCAGTTCTTTTGG - Intergenic
1144856651 17:18272434-18272456 TGACTTGTTTTCAGTTATTTTGG - Intronic
1145715404 17:27014949-27014971 TTCATTTTTTTCAGTTCTTTTGG - Intergenic
1145987735 17:29058620-29058642 GATCCTGTTTTCAGTTCTTTTGG - Intergenic
1146036953 17:29415328-29415350 TGTACTGTTTTCAGTTCTTTTGG + Intronic
1146152824 17:30491091-30491113 TGTAATATTTTTAGTCCTTCAGG + Intronic
1146342843 17:32036809-32036831 ACCAATGTTTTCATTTCTTTGGG + Intronic
1146576134 17:33993272-33993294 TGGTATGGTTTCAGTTTTTTTGG + Intronic
1146739746 17:35272762-35272784 AGTAATGTTTCCATATCTTTAGG - Exonic
1148571656 17:48674816-48674838 TATAATGTTCTCAATTATTTTGG - Intergenic
1148833391 17:50451253-50451275 ACACATGTTTTCAGTTCTTTTGG + Intronic
1149059008 17:52399647-52399669 TGTAATGATATCATTTCCTTTGG - Intergenic
1149111772 17:53041581-53041603 TGTAATGATTTCCTTTATTTTGG + Intergenic
1149376952 17:56053635-56053657 TGTACTGATTTCTTTTCTTTGGG + Intergenic
1149502930 17:57168656-57168678 AATATTGTTTTCAGTTCTTTTGG + Intergenic
1149948898 17:60963168-60963190 TGTGATGCCTTCAGTTCCTTTGG + Intronic
1149977163 17:61277994-61278016 GGGTATGTTTTCATTTCTTTTGG - Intronic
1150568108 17:66360890-66360912 AGTCGTGTTTTCATTTCTTTTGG + Intronic
1150876134 17:68972497-68972519 TGTAATATTTTCATTTATTGAGG + Intergenic
1151272622 17:73008591-73008613 AGCACCGTTTTCAGTTCTTTTGG - Intronic
1151515424 17:74591550-74591572 AGATATGTTTTCAGTTCTCTTGG - Intronic
1151907531 17:77058493-77058515 CCTATTGTTTTCAATTCTTTTGG - Intergenic
1153325632 18:3816926-3816948 TGTAATGTTTTTACTTTTGTAGG + Intronic
1153506057 18:5799971-5799993 GGAAATGTTTTCATTTCTCTTGG + Intergenic
1153596018 18:6725964-6725986 GGTAATGTTTTCAGGTTTTATGG - Intergenic
1153862576 18:9228310-9228332 TGTACTGATTTCCTTTCTTTTGG + Intronic
1154096212 18:11417496-11417518 AGTAATGTTTTCAGCTTTGTTGG - Intergenic
1154286806 18:13065378-13065400 TTTAATGTTTACAGTTCTTAGGG + Intronic
1155019225 18:21879662-21879684 TGTAAGTTTTTCAGTTTATTTGG - Intergenic
1155193102 18:23448780-23448802 TTATCTGTTTTCAGTTCTTTGGG + Intergenic
1155309184 18:24507581-24507603 TGTACTGATTTCTTTTCTTTGGG - Intergenic
1155903159 18:31416250-31416272 TATAATGATTTCTATTCTTTTGG + Intergenic
1156025460 18:32648898-32648920 TATAATGATTTCCTTTCTTTTGG + Intergenic
1156050561 18:32928493-32928515 TGGAACGTTTTCATTTATTTTGG - Intergenic
1156265236 18:35482073-35482095 TGTGATGTTTTCATTTCTCTTGG + Intronic
1156828682 18:41464878-41464900 AGTATTGTTTTCAGTTCTGGAGG + Intergenic
1157019916 18:43768427-43768449 TGTCATGATTTCACTTCTTTTGG - Intergenic
1157652308 18:49346136-49346158 AGAAACGTTTTCAGTTCTTCTGG - Intronic
1158043717 18:53129823-53129845 ACTTATGTTTTCATTTCTTTTGG + Intronic
1158097759 18:53793563-53793585 TTTATTTTTTTCATTTCTTTAGG - Intergenic
1158349662 18:56552042-56552064 TAAAATTTTTTCAGTTCTTGAGG - Intergenic
1158470022 18:57727896-57727918 GGGAATGTTTTCAGTGCTATGGG - Intronic
1158622140 18:59042143-59042165 TGCAGTGTGTTCAGGTCTTTGGG + Intergenic
1159246721 18:65815256-65815278 TTTAATGTATTCAGTTTTTCTGG + Intronic
1159540997 18:69776072-69776094 TGTCATGTTTTCAATTTTTTTGG - Intronic
1159543458 18:69810957-69810979 TGTACTGATTTCATTTCCTTTGG - Intronic
1159557540 18:69961127-69961149 TGTAAATTTTGCTGTTCTTTTGG - Intronic
1160020580 18:75177539-75177561 TGTCATGCTTTCTGTTCTCTGGG + Intergenic
1160489313 18:79323789-79323811 TGTACTGATTTCCTTTCTTTGGG + Intronic
1161717310 19:5883582-5883604 TGTTAGGTTTTCAGCTCCTTTGG - Intronic
1162012499 19:7826269-7826291 ATTTCTGTTTTCAGTTCTTTTGG - Intergenic
1163067375 19:14808277-14808299 TGTAATGATTTCTTTTCTTTGGG - Intronic
1163238673 19:16044948-16044970 GGTCCTGTTTTCAGTTCTTTTGG - Intergenic
1164945568 19:32290408-32290430 GGCCCTGTTTTCAGTTCTTTTGG + Intergenic
1165376200 19:35444213-35444235 GGAAATGTTTTCAGTGCTGTTGG - Intronic
1165642447 19:37401709-37401731 GGTCTTGTATTCAGTTCTTTTGG + Intergenic
1165705269 19:37971547-37971569 TGTCATGTTTTTTGTTTTTTGGG + Intronic
1165756175 19:38294365-38294387 TGTCATGTGTTCAATTCTTGGGG + Intronic
925320681 2:2964895-2964917 AGCTCTGTTTTCAGTTCTTTGGG - Intergenic
925598671 2:5586043-5586065 TTATATGTTTTCATTTCTTTTGG - Intergenic
925961766 2:9023870-9023892 TGTAATGATTTCTTTTCCTTTGG - Intergenic
926248004 2:11134764-11134786 GGGAGTGATTTCAGTTCTTTTGG + Intronic
926708025 2:15850359-15850381 TGTATTGTTTCCAGTCCTTTTGG + Intergenic
927128472 2:20035923-20035945 TCTATTTTTTTCAGTCCTTTGGG - Intronic
927439242 2:23099522-23099544 TGTTTTGTTTTCAATTCTTTAGG + Intergenic
927697444 2:25247757-25247779 TGTAATGATTTCTGCTCCTTGGG - Intronic
928191202 2:29170240-29170262 TGTACTGATTTCCTTTCTTTTGG + Intronic
928601485 2:32908184-32908206 GGTCATGTTTTCACTTCTCTTGG + Intergenic
928803963 2:35127997-35128019 TGTTATGATTTCAGTTCTTTTGG - Intergenic
928934482 2:36660996-36661018 GATACTGTTTTCAATTCTTTTGG + Intergenic
929091341 2:38220521-38220543 TGTCCTGTTTTCATTTCTCTCGG - Intergenic
929471802 2:42201507-42201529 TATAATGGTTTCAATTCCTTTGG - Intronic
929608238 2:43250058-43250080 GGTACTGCTTTCAGTTCTCTTGG - Intronic
929806525 2:45151126-45151148 TGAGATGTCTTCAGTTCTTCTGG - Intergenic
929902853 2:46020938-46020960 GGTATTGTTGCCAGTTCTTTGGG + Intronic
930592646 2:53347463-53347485 TATACTGTTTTCCCTTCTTTTGG + Intergenic
930759031 2:55011685-55011707 TGTTTTGTTTTTAGTTTTTTTGG - Intronic
930931974 2:56896267-56896289 TTTACTGTTTTCAGTGCCTTTGG + Intergenic
931541803 2:63337470-63337492 TATAGTGATTTCATTTCTTTTGG + Intronic
931575905 2:63718240-63718262 TATAATGATTTCTTTTCTTTTGG + Intronic
931596361 2:63949313-63949335 TGAAATGTTTGCAGTTATTTTGG - Intronic
931927646 2:67091620-67091642 TGTACTGATTTCCTTTCTTTTGG - Intergenic
932527059 2:72481479-72481501 TTTAATGATTCCTGTTCTTTTGG - Intronic
932661569 2:73657851-73657873 CATAATTTTTTCAGTTCTCTTGG + Intergenic
932978316 2:76631452-76631474 TACAATTTGTTCAGTTCTTTTGG + Intergenic
933225645 2:79745887-79745909 TGCCCTGCTTTCAGTTCTTTTGG + Intronic
933385436 2:81604930-81604952 TGTAATGAATTCATTTCTATAGG + Intergenic
933421369 2:82049980-82050002 ATAAATGTATTCAGTTCTTTAGG - Intergenic
933467221 2:82668378-82668400 TGTAATGTTTTCTTTTCATGAGG - Intergenic
933556620 2:83838065-83838087 AGTAATGATTTCAGTCCGTTTGG - Intergenic
934033565 2:88068995-88069017 TGTGATGTTTTCAGTTTTATAGG + Intronic
934041833 2:88133492-88133514 TGTGCTGTTTTCAATCCTTTTGG + Intergenic
934551362 2:95264577-95264599 ATTAATGTTTTAGGTTCTTTAGG + Intergenic
934684293 2:96309145-96309167 AGACATGTTTTCAGTTCTGTTGG - Intergenic
935019830 2:99219319-99219341 TGTTTTGTTTTCAGATATTTAGG + Intronic
935132861 2:100274475-100274497 TATAATGTTTTCACATCTTGGGG + Exonic
935288155 2:101584288-101584310 TGTAATGATTTCCTTTCTTTTGG + Intergenic
935361911 2:102252386-102252408 TGTAATGATTTCATTTCCTTTGG + Intergenic
935440446 2:103088961-103088983 CATTAAGTTTTCAGTTCTTTTGG - Intergenic
935892638 2:107695793-107695815 TTTCATATATTCAGTTCTTTTGG - Intergenic
936170315 2:110165795-110165817 TGGTACCTTTTCAGTTCTTTTGG - Intronic
936852563 2:116918360-116918382 TGTGATATTGTCAGTTCTCTGGG + Intergenic
937169341 2:119850161-119850183 TTTAAAGTTTTCTGTTCTTGTGG + Intronic
937961386 2:127462731-127462753 GGACATGTTTTCAGTTCTCTTGG - Intronic
938147000 2:128843087-128843109 TATAATGATTTCTTTTCTTTTGG + Intergenic
938375763 2:130805270-130805292 GATCTTGTTTTCAGTTCTTTTGG - Intergenic
938512122 2:131960860-131960882 TGCAATGTTTTCTGTTCTACAGG - Intergenic
938787321 2:134643017-134643039 TGTAATGTTTTCAATTTCATTGG - Intronic
938875211 2:135525542-135525564 AATCCTGTTTTCAGTTCTTTCGG - Intronic
939204753 2:139086488-139086510 CATACTGATTTCAGTTCTTTTGG + Intergenic
939268083 2:139901560-139901582 TGTAAAGTTTTAAGTTGCTTGGG - Intergenic
939269100 2:139914255-139914277 TGTTATGTTTTATGTTTTTTGGG - Intergenic
939311418 2:140482278-140482300 TGTAATGTTTTCTGTTAATTAGG + Intronic
939577661 2:143915385-143915407 TGTCATGTCTTGAGATCTTTAGG + Intergenic
939667932 2:144973534-144973556 TTTAATGTTTTAAGTTAGTTTGG - Intergenic
939976734 2:148726279-148726301 GGTCTTGTTTTCAGTTCTTTTGG + Intronic
940027906 2:149228083-149228105 AGTAATGTGTTCAGTTTATTGGG - Intergenic
940097858 2:149998683-149998705 AGTTTTGTTTTTAGTTCTTTGGG - Intergenic
940159420 2:150695438-150695460 TGAAATTTTTTCAGCTCTATTGG - Intergenic
940177297 2:150892614-150892636 TCGAATATTTTCACTTCTTTGGG + Intergenic
940380147 2:153005505-153005527 TGCAACGTTTTCTGTGCTTTTGG + Intergenic
940928666 2:159398606-159398628 TGTAATGCTTTGAGCTGTTTAGG - Intronic
941060416 2:160841068-160841090 TATAATGTTTTCATTTGATTTGG - Intergenic
941594509 2:167458441-167458463 GGCCATGTTTTCAATTCTTTGGG + Intergenic
941993678 2:171581085-171581107 TGTTCTGTTTTTAGCTCTTTAGG + Intergenic
942523836 2:176831972-176831994 TTTATTGTCTTCAGTTGTTTTGG - Intergenic
942600076 2:177632026-177632048 TGTAATCTTTCCATTTGTTTTGG + Intronic
942927581 2:181452300-181452322 TGTATTGATTTCCTTTCTTTAGG + Intergenic
943125474 2:183790588-183790610 TGTAATGATTTCCTTTCCTTTGG + Intergenic
943881229 2:193146994-193147016 TGTACTGATTTCATTTCCTTTGG - Intergenic
943995801 2:194763984-194764006 TGTATTATTTCTAGTTCTTTGGG - Intergenic
944750907 2:202708550-202708572 AATACTGATTTCAGTTCTTTTGG + Intronic
944830016 2:203524164-203524186 TGTAATGTTCTTAGTCATTTGGG - Intronic
944978282 2:205083709-205083731 TGTCTTCTTTTCATTTCTTTAGG + Intronic
944999024 2:205328840-205328862 TGTTGTGTTTTTATTTCTTTTGG + Intronic
945166079 2:206948083-206948105 TGACATGTTTTCAATTCATTTGG - Intronic
945211220 2:207384575-207384597 TATATTGTTTTCCTTTCTTTTGG - Intergenic
945602068 2:211880770-211880792 TGTAAACTGTTCATTTCTTTGGG - Intronic
945895806 2:215480259-215480281 TGTTTTGTTTTCAGGTCCTTGGG + Intergenic
946076856 2:217081033-217081055 TGTGATGTCTTTAGTTTTTTAGG - Intergenic
946504984 2:220289485-220289507 TATAATGTTTTCATTTTTGTTGG - Intergenic
946620059 2:221552063-221552085 TGTAATGCTTCCAGTCCTTAGGG - Intronic
946693514 2:222328758-222328780 CGTACTGATTTCAGTTCTTTTGG + Intergenic
946884542 2:224210072-224210094 TGTAACGTTTTGGGTTCTTCTGG + Intergenic
947089835 2:226497411-226497433 TGGAATGTTTTCTTTTTTTTTGG - Intergenic
947439020 2:230101150-230101172 TGTACTGATTTCCTTTCTTTTGG + Intergenic
947862527 2:233371051-233371073 TGACCTGTTTTCATTTCTTTTGG + Intronic
947922417 2:233888782-233888804 TGAAATATTTTAATTTCTTTTGG + Intergenic
948618823 2:239220358-239220380 TCTAATGTTTTTATTTGTTTGGG - Intronic
948862414 2:240759227-240759249 TGTGATGTTTTGACTTCCTTGGG + Intronic
1168875313 20:1167823-1167845 TCAGATGTTTTCAGTTCATTTGG + Exonic
1169629147 20:7606712-7606734 TGTACTGATTTCCTTTCTTTTGG - Intergenic
1169673543 20:8131127-8131149 TTGAACGTTTTCATTTCTTTTGG + Intergenic
1169761742 20:9102616-9102638 TGAAATGTTTTTAGTTCTTTAGG + Intronic
1169991629 20:11510539-11510561 TGTACTGATTTCCTTTCTTTTGG - Intergenic
1169996822 20:11566995-11567017 TGTACTGATTTCCTTTCTTTTGG + Intergenic
1170101559 20:12705785-12705807 TTTATTTTTGTCAGTTCTTTGGG + Intergenic
1170111909 20:12813981-12814003 TATACTGATTTCTGTTCTTTTGG - Intergenic
1170225360 20:13986113-13986135 GGAAATGTTTTCAATTCTCTTGG + Intronic
1170225407 20:13986739-13986761 TATTATGTTTTCATTTCTCTTGG + Intronic
1170254728 20:14327659-14327681 TTTAATATTTTCATTTGTTTTGG + Intronic
1170410647 20:16087327-16087349 TGTACTGATTTCCATTCTTTTGG - Intergenic
1170917475 20:20641639-20641661 CATAATCTTTTCAGTTATTTAGG - Intronic
1171492958 20:25534374-25534396 GATGCTGTTTTCAGTTCTTTTGG - Intronic
1171566463 20:26195470-26195492 TATACTGATTTCAGTTCCTTTGG - Intergenic
1171938410 20:31299341-31299363 TGTACTGATTTCCTTTCTTTTGG - Intergenic
1172354552 20:34270380-34270402 TGTTTTGTTTTCTGTTATTTAGG + Intergenic
1172532065 20:35638649-35638671 CATAATGTTTCCATTTCTTTTGG - Intronic
1172560295 20:35882116-35882138 TTTAATGTTTACAATTCTTATGG - Intronic
1173478257 20:43378625-43378647 TGTAATGTTTTGTGTTTTTCTGG - Intergenic
1174297390 20:49558554-49558576 TCCAACGTTTTCAATTCTTTAGG - Intronic
1174478311 20:50813114-50813136 TGGTCTGTTTTCATTTCTTTCGG + Intronic
1174495016 20:50933373-50933395 TGTAATATTCTCAGTTTTTTTGG - Intergenic
1175356902 20:58375759-58375781 TGTATTATTGTCATTTCTTTGGG + Intergenic
1175357484 20:58380410-58380432 TTTAATTTTCTCAGTACTTTAGG + Intergenic
1175471098 20:59229291-59229313 TATAATGATTTCCCTTCTTTTGG + Intronic
1175513342 20:59550724-59550746 AGTTGTGTTTTAAGTTCTTTGGG - Intergenic
1176672626 21:9748719-9748741 TGTCCTGGTTTCAGTTCTCTTGG - Intergenic
1176881072 21:14194309-14194331 GTTACTGTTTTCAATTCTTTTGG - Intronic
1176926828 21:14760369-14760391 TGTCCTGATTTCAGCTCTTTTGG - Intergenic
1176955271 21:15095417-15095439 TTTAAAGTTTTCTGTTCTTATGG + Intergenic
1177000672 21:15608224-15608246 GGTAAGGTTTTCTGTTCTTTTGG - Intergenic
1177090664 21:16763432-16763454 TGTACTGATTTCCATTCTTTTGG - Intergenic
1177212293 21:18086627-18086649 TGTAATTTCTTCAGTGGTTTAGG + Intronic
1177399165 21:20579843-20579865 TGAAATGTTGTCAGTTCTATAGG + Intergenic
1177456735 21:21349587-21349609 TGTACTGATTTCCTTTCTTTTGG - Intronic
1177566079 21:22822251-22822273 TGTAATGTTTTGTATACTTTTGG - Intergenic
1177725751 21:24965145-24965167 AGTAATTTTGTTAGTTCTTTGGG - Intergenic
1177875785 21:26629838-26629860 GGTACTGATTTCCGTTCTTTTGG + Intergenic
1178335495 21:31739186-31739208 TGTCTTGTTTTCAGTTGTGTGGG - Intergenic
1179931370 21:44573131-44573153 TGTAATGTATTCTTTTCCTTGGG - Intronic
1181117221 22:20639794-20639816 TGTACTGATTTCCTTTCTTTTGG - Intergenic
1181273507 22:21674326-21674348 GGTAATGTTTTCAGTTTCTGTGG - Intronic
1181380861 22:22502447-22502469 TGTTATATTTTCAATTCTCTTGG - Intronic
1181529061 22:23505851-23505873 AGTAGTGTTTTAAATTCTTTGGG + Intergenic
1181613356 22:24034589-24034611 GGACATGTTTTCATTTCTTTTGG + Intronic
1182127003 22:27823153-27823175 AGACCTGTTTTCAGTTCTTTTGG - Intergenic
1182166274 22:28177337-28177359 TTTGATATTGTCAGTTCTTTTGG - Intronic
1182631853 22:31692163-31692185 TGGCATGTTTTCAATTCTTTTGG + Intronic
1182631988 22:31693553-31693575 TGAAATGTTTTCAACTCATTTGG + Intronic
1182720199 22:32392052-32392074 TTTTATGTTTTCATTTCTTTTGG - Intronic
1183270451 22:36859261-36859283 TGTATTATTTCTAGTTCTTTGGG + Intergenic
1183757622 22:39784404-39784426 TGTATTGATTTCCTTTCTTTTGG - Intronic
1183855581 22:40631688-40631710 TGAAATGTTTTAAGTAATTTAGG - Intronic
1184738765 22:46414790-46414812 GTTCCTGTTTTCAGTTCTTTTGG - Intronic
949423627 3:3892093-3892115 TGAAATGGTTACAATTCTTTGGG + Intronic
949441482 3:4085746-4085768 TCTCATGTTTGTAGTTCTTTAGG - Intronic
949608809 3:5682601-5682623 TGTACTGTTTTAATTTCATTTGG - Intergenic
950216035 3:11160185-11160207 TGTCATGTTATCAGTTTTTGTGG + Intronic
950607788 3:14098843-14098865 GGTGATGTTTTCAGTTCACTTGG + Intergenic
950668831 3:14513208-14513230 TTTCATGTTTTCATTTCTCTTGG + Intronic
950914025 3:16625407-16625429 TATAATGATTTCCTTTCTTTTGG - Intronic
950926040 3:16743242-16743264 TCTTACATTTTCAGTTCTTTTGG + Intergenic
950958517 3:17080156-17080178 CGTGATGTTTTCTGTCCTTTTGG - Intronic
951104349 3:18725698-18725720 TGCAATGTTTTCTGTGGTTTGGG + Intergenic
951177366 3:19617653-19617675 TATAATGATTTCCATTCTTTTGG + Intergenic
951215207 3:20017669-20017691 TTCAATGTTGTCAGTTCTTTTGG - Intergenic
951215217 3:20017791-20017813 TTCAATGTTGTCAGTTCTTTTGG - Intergenic
951282039 3:20763264-20763286 TATACTGATTTCATTTCTTTTGG - Intergenic
951629418 3:24702857-24702879 TATAAGGTTTTGAGTTCTCTTGG + Intergenic
951825923 3:26868338-26868360 TGTAATATTTTCTGTCCCTTTGG + Intergenic
951966757 3:28395415-28395437 GGTCCTGTTTTCAGTTCTTTTGG - Intronic
952767202 3:36964280-36964302 GTATATGTTTTCAGTTCTTTGGG + Intergenic
952819763 3:37476172-37476194 GATCTTGTTTTCAGTTCTTTGGG + Intronic
953012780 3:39043322-39043344 TATACTGATTTCATTTCTTTTGG - Intergenic
953052750 3:39360726-39360748 TGTATTGATTTCCTTTCTTTTGG - Intergenic
954157305 3:48693497-48693519 AGCAATGTTTTCAGTCTTTTAGG - Intronic
954552434 3:51493145-51493167 AGCCTTGTTTTCAGTTCTTTTGG - Intronic
954889839 3:53915391-53915413 GATCCTGTTTTCAGTTCTTTTGG + Intergenic
955125199 3:56104419-56104441 TGAAATGTTTATAGGTCTTTGGG - Intronic
955616611 3:60814751-60814773 AGTTCTGTTTTAAGTTCTTTGGG + Intronic
955718081 3:61852075-61852097 TAAAATATTTTGAGTTCTTTTGG + Intronic
956303527 3:67798500-67798522 TGTAATGATTTCTTTTCCTTTGG + Intergenic
956317939 3:67960350-67960372 TATAATGATTTCCTTTCTTTTGG - Intergenic
956385887 3:68718791-68718813 TGCACTTTTCTCAGTTCTTTGGG + Intergenic
956401014 3:68879882-68879904 AGAAATGTTTTGACTTCTTTGGG - Intronic
957027758 3:75203724-75203746 TGTACAGATTTCAGATCTTTTGG + Intergenic
957105482 3:75882461-75882483 TATAATGATTTCTTTTCTTTTGG - Intergenic
957111698 3:75969295-75969317 TATACTGATTTCAGTTCCTTTGG + Intronic
957111710 3:75969399-75969421 TATACTGATTTCAGTTCCTTTGG + Intronic
957615805 3:82525182-82525204 TGTACTGATTTCCTTTCTTTTGG + Intergenic
957860439 3:85941957-85941979 TGTAATCGTTTCAATTTTTTAGG + Intronic
958121166 3:89290468-89290490 TGTATTGTTTTCAAGTGTTTTGG - Intronic
958549959 3:95599604-95599626 TGTAATATTTTTAGGTCTTATGG - Intergenic
958920165 3:100096268-100096290 TATACTGATTTCATTTCTTTGGG - Intronic
958920352 3:100098652-100098674 TGTAAAGTTTTCAGGGCTGTAGG - Intronic
959084736 3:101839733-101839755 TATAAAATATTCAGTTCTTTGGG + Intronic
959196939 3:103195736-103195758 TATATTGTTTTCTGTTCTGTTGG + Intergenic
959229087 3:103624234-103624256 TGTATTGTTTTCCTTTCTTTTGG + Intergenic
959249271 3:103920530-103920552 AGTTATGTTTTAAGTTCTTTGGG - Intergenic
959564602 3:107821685-107821707 AATAATGCTTTCAGTGCTTTAGG + Intergenic
959717959 3:109454081-109454103 TATACTGTTTTCCTTTCTTTTGG - Intergenic
959730180 3:109592013-109592035 TGTTCTATTTTTAGTTCTTTGGG - Intergenic
960004321 3:112766536-112766558 TGTAATGCTTACAGTTCTGCAGG - Intronic
960050657 3:113236070-113236092 TGTAATGATTTCCTTTCCTTTGG - Intronic
960123154 3:113968117-113968139 TGTATTGATTTCCTTTCTTTTGG + Intronic
960961176 3:123071568-123071590 TGTAATGTGTTTATTTCTGTGGG - Intronic
961153668 3:124660988-124661010 TGTAATGCTTGCTGTTCTTAGGG + Intronic
961226196 3:125249685-125249707 GATAATGATTTCAGTTCCTTTGG - Intronic
961341131 3:126220600-126220622 AGGAATGTGTTCATTTCTTTAGG - Intergenic
961902582 3:130227452-130227474 TCTAGTGTTCTCATTTCTTTGGG - Intergenic
962128367 3:132646597-132646619 TTTTATGTGTTCAGTTCTCTTGG - Intronic
962139789 3:132777213-132777235 CTTAATGTTTTCAATTCTCTTGG + Intergenic
962175512 3:133149973-133149995 CATACTGATTTCAGTTCTTTTGG + Intronic
962468570 3:135684542-135684564 TATACTGTTTTCCTTTCTTTGGG - Intergenic
962514092 3:136132627-136132649 TCTAATCTTTCCAGTTATTTAGG - Intronic
962534736 3:136317610-136317632 TATAAGGTTTTCAATTTTTTAGG + Intronic
963168740 3:142230580-142230602 TGTACTGATTTCCTTTCTTTGGG + Intergenic
963193651 3:142502172-142502194 TGTTCTATTTTCAGTTCTTTGGG - Intronic
963242266 3:143018536-143018558 ACTTATGTTTTCAGTTCTCTTGG + Intronic
963242323 3:143019208-143019230 GGAAATGTTTTCTGTTCTCTGGG + Intronic
963548268 3:146688303-146688325 TGTACTGGTTTCAGTTCCTTTGG + Intergenic
963592116 3:147273612-147273634 TGTACTGATTTCCTTTCTTTTGG - Intergenic
963638822 3:147833957-147833979 AGTTCTGTTTTAAGTTCTTTGGG + Intergenic
963805833 3:149721634-149721656 TGTAATCTCTTCAATTTTTTTGG + Intronic
964180131 3:153873745-153873767 TGTACTGATTTCCTTTCTTTTGG - Intergenic
964319286 3:155477904-155477926 TATAATGATTTCCTTTCTTTTGG - Intronic
964491715 3:157243111-157243133 TGACATATTTTCAGTTCTTTTGG - Intergenic
964520329 3:157559638-157559660 TGGTATGTTTTTATTTCTTTTGG + Intronic
965491774 3:169346132-169346154 TACAATGTTTTCCATTCTTTAGG + Intronic
965602740 3:170471018-170471040 TGTAACATTTTGAGCTCTTTGGG - Intronic
965667605 3:171111668-171111690 TGTACTGATTTCATTTCCTTTGG - Intronic
966011130 3:175078916-175078938 TGTTATGTTTTCATTTCTCTTGG + Intronic
966086598 3:176075798-176075820 TGTAATGATTTCTTTTCGTTTGG - Intergenic
966539371 3:181072719-181072741 TGTTATGATTTCACTTCTTTTGG + Intergenic
966621763 3:181972318-181972340 GGTGATGTTTTCATTTGTTTCGG + Intergenic
967000845 3:185332874-185332896 GGTCCTGCTTTCAGTTCTTTTGG + Intronic
967342221 3:188411419-188411441 TGTAATGATTTCTTTTCCTTTGG - Intronic
967440855 3:189507014-189507036 TGTACTGATTTCCTTTCTTTGGG - Intergenic
967762944 3:193245522-193245544 CGTAATGGCTTCAGTTCATTTGG + Intronic
967928078 3:194668261-194668283 AGACATGTTTTCATTTCTTTCGG + Intronic
970114207 4:12675337-12675359 TTTAATTTTTTCAGTACCTTTGG + Intergenic
970643112 4:18089582-18089604 TGTAATTGTTTCAGGTGTTTTGG - Intergenic
971306445 4:25486439-25486461 AGCAATGTTTGCAATTCTTTTGG + Intergenic
971355560 4:25891800-25891822 TTTCAGGTTTTCATTTCTTTTGG + Intronic
971637565 4:29081570-29081592 TAAAATGTTTTCAGGTATTTGGG + Intergenic
971891882 4:32534711-32534733 TATACTGATTTCATTTCTTTTGG - Intergenic
972005494 4:34098539-34098561 CATACTGATTTCAGTTCTTTTGG - Intergenic
972036124 4:34523797-34523819 TGTATTTTTTACAGTTCTTGTGG + Intergenic
972058602 4:34837391-34837413 TGTAATGTATACATTTCTATAGG - Intergenic
972227789 4:37033851-37033873 GGTAATGTTTTCAGGTTTTATGG - Intergenic
972510694 4:39766082-39766104 GTTACTGCTTTCAGTTCTTTTGG + Intronic
972758122 4:42072494-42072516 TTTATTCTTTTCAGTTATTTAGG + Intronic
972857371 4:43122891-43122913 TGTATTGTCTTCAGTTCTGTAGG + Intergenic
972886627 4:43499215-43499237 TGTAAGTTTTTCAGCTCCTTTGG + Intergenic
973031212 4:45342770-45342792 TGTAGTATTTTTATTTCTTTGGG + Intergenic
973871440 4:55170682-55170704 GGGCATGTTTTCATTTCTTTGGG + Intergenic
974346955 4:60694650-60694672 TTGAAAGTTTTCAGTTATTTAGG + Intergenic
975206812 4:71653510-71653532 TCTCATGGTCTCAGTTCTTTAGG - Intergenic
975268855 4:72405198-72405220 GGTCCTGATTTCAGTTCTTTTGG - Intronic
975350108 4:73336509-73336531 TATACTGTTTTCCTTTCTTTTGG - Intergenic
975504537 4:75123368-75123390 TATAATCTTTGCTGTTCTTTGGG + Intergenic
975785437 4:77882812-77882834 TCATATGTTTTCACTTCTTTGGG + Intronic
975971832 4:80049031-80049053 TGTAGTGTTCTCAATTCTTTTGG + Intronic
976071964 4:81251724-81251746 TATACTGATTTCATTTCTTTTGG + Intergenic
976093042 4:81476712-81476734 TGTTATGATTTCCGTTCTTTTGG - Intronic
976227632 4:82808692-82808714 TGTACTGATTTCCTTTCTTTTGG - Intergenic
976310442 4:83606528-83606550 TGTTATTTTTACAGTGCTTTTGG - Intergenic
976582914 4:86760870-86760892 GGTAATTTTCTAAGTTCTTTTGG - Intronic
976762235 4:88561978-88562000 TGTACTGATTTCCATTCTTTTGG + Intronic
976786051 4:88822819-88822841 TTTAATTTTTTCTGTTCTTAGGG + Intronic
976909492 4:90283812-90283834 TGTATTGATTTCCTTTCTTTTGG + Intronic
976960920 4:90971763-90971785 TGTACTGTATTCTGTTATTTTGG - Intronic
977072394 4:92407475-92407497 AGTTATTTTTTAAGTTCTTTGGG + Intronic
977092258 4:92692632-92692654 TGTAATGTTTACAGTATATTTGG + Intronic
977306614 4:95331302-95331324 TGTAATGATTTCTTTTCCTTTGG + Intronic
977367607 4:96090834-96090856 TATATTGTTTTCCTTTCTTTTGG - Intergenic
977461271 4:97328575-97328597 TTGAATCTTTTGAGTTCTTTGGG + Intronic
977496972 4:97788558-97788580 TATAATGATTTCCTTTCTTTTGG + Intronic
977564663 4:98568799-98568821 TATAATACTTTCAATTCTTTAGG - Intronic
977873126 4:102117329-102117351 TGTACTGATTTCCTTTCTTTGGG + Intergenic
978072374 4:104490373-104490395 TGTGATGTGTCCAGTCCTTTGGG + Intronic
978572142 4:110149287-110149309 TATAATGATTTCATTTCCTTTGG - Intronic
978866613 4:113520583-113520605 TTTAATGATTTTAGTACTTTAGG - Intronic
978920109 4:114173796-114173818 TGTTATGTTTTCAGTGATTAGGG + Intergenic
978985914 4:115012697-115012719 TGTACTGATTTCCTTTCTTTTGG - Intronic
978997020 4:115169373-115169395 TGTAGTGTTTTCTGTTTTGTGGG + Intergenic
979171461 4:117604549-117604571 TTTCATGTTTTCATTTCTTTTGG + Intergenic
979180351 4:117718609-117718631 TGTAATTTTCTCAGTGGTTTAGG - Intergenic
979299678 4:119073030-119073052 TGTACTGATTTCCTTTCTTTTGG - Intergenic
979515342 4:121602891-121602913 CGTAAGTTTTTCAGTTCCTTTGG + Intergenic
979917141 4:126450261-126450283 GGTTATGTTTTCTATTCTTTTGG + Intergenic
980487729 4:133481199-133481221 TAAAAAGTTTTCATTTCTTTAGG - Intergenic
980566153 4:134545664-134545686 TATAATGTTTTCATTTTTATTGG + Intergenic
980745480 4:137007508-137007530 TATACTGATTTCAGTTCTTTTGG + Intergenic
981102515 4:140845111-140845133 TGGAATGTCTTCATTTCTCTGGG + Intergenic
981123933 4:141084218-141084240 GAAAATGTTTTCAGTTATTTGGG - Intronic
981138040 4:141235595-141235617 CGTAATTCTTGCAGTTCTTTTGG - Intergenic
981397440 4:144270401-144270423 TGTAATGCTTTCTCTTCCTTTGG - Intergenic
981620346 4:146690184-146690206 TGTACTGGTTTCATATCTTTTGG - Intergenic
982119247 4:152125055-152125077 TGTTTTGTTTTCATTTTTTTTGG + Intergenic
982160046 4:152559440-152559462 TGTGATGATTTCAGTTATTCAGG - Intergenic
982186906 4:152811964-152811986 TGCAATGTTTGCATATCTTTTGG + Intronic
982222014 4:153132917-153132939 AGACATGTTTTCAGTTCTCTTGG + Intergenic
982577389 4:157131895-157131917 TGACATGTTTTCAGCTCCTTTGG + Intronic
982673365 4:158348473-158348495 TGTAATGGTATCAGTCCATTTGG - Intronic
982943691 4:161590892-161590914 AGACATGTTTTCAGTTCTTTGGG - Intronic
982954684 4:161749186-161749208 TATAATGATTTCCTTTCTTTTGG - Intronic
983125630 4:163947925-163947947 TGTAACATTTCCATTTCTTTTGG + Intronic
983423009 4:167544751-167544773 TGTAATGATTTCTGTTCCTTTGG + Intergenic
983748941 4:171238953-171238975 TGTCATGTTTTCATTTTCTTAGG + Intergenic
983799803 4:171913028-171913050 TGTACTGATTTCCTTTCTTTTGG + Intronic
984211254 4:176851570-176851592 TTTTATGTTTTCAGTTTTTTAGG - Intergenic
984443919 4:179809237-179809259 TGTACTGATTTCATTTCCTTTGG - Intergenic
984579144 4:181489884-181489906 TGTAATATTTCCAGATCATTTGG + Intergenic
984691407 4:182730737-182730759 TGAAATATTTTCAGATCTATGGG - Intronic
985051294 4:185994797-185994819 TATAATGATTTCTTTTCTTTTGG - Intergenic
985402097 4:189603112-189603134 TGTCCTGGTTTCAGTTCTCTTGG + Intergenic
985429202 4:189861927-189861949 TTTTCTGTTTTCATTTCTTTGGG + Intergenic
986033332 5:3913941-3913963 AATAATGTTTCCTGTTCTTTAGG - Intergenic
986394044 5:7310889-7310911 AGTAATGATTTCATTTCCTTTGG + Intergenic
986651701 5:9970603-9970625 TGTACTGATTTCCTTTCTTTTGG - Intergenic
986755191 5:10829234-10829256 TATAATGATTTCTTTTCTTTTGG + Intergenic
986889322 5:12281900-12281922 TGTAAAGAGATCAGTTCTTTAGG - Intergenic
987061030 5:14244098-14244120 TGGAACGTTTTGAGGTCTTTGGG + Intronic
987459214 5:18187086-18187108 TGTATTGATTTCAATTCCTTTGG + Intergenic
987517298 5:18928425-18928447 TATTATGTTTTTGGTTCTTTTGG + Intergenic
987659050 5:20848060-20848082 TATACTGGTTTCATTTCTTTTGG + Intergenic
987728180 5:21730712-21730734 TGTTTTGTTTTCATTTGTTTGGG - Intergenic
988094962 5:26594545-26594567 AGTAATATTTCCAGTTCTGTTGG + Intergenic
988329436 5:29815785-29815807 TGTACTGATTTCATTTCCTTTGG - Intergenic
988343833 5:30012005-30012027 TGTAATGTTTTCTCTTTTTTTGG + Intergenic
988607780 5:32695190-32695212 TGTACTGATTTCCTTTCTTTTGG + Intronic
988764628 5:34357918-34357940 TATACTGGTTTCATTTCTTTTGG - Intergenic
988873992 5:35423508-35423530 TTTAATTTTTTTAGTTCTTGGGG - Intergenic
989159158 5:38373745-38373767 TATAATGATTTCTTTTCTTTTGG + Intronic
989494420 5:42095112-42095134 TATACTGATTTCATTTCTTTTGG + Intergenic
990510492 5:56484912-56484934 AAATATGTTTTCAGTTCTTTTGG - Intergenic
991008677 5:61858296-61858318 TGTTATGATTTCAGTTCTTTGGG - Intergenic
991172216 5:63641722-63641744 AGTAATGTTTTCTTTTCCTTTGG + Intergenic
991232959 5:64358573-64358595 TGTACTTTTTTCAGGTCTATGGG - Intronic
991394537 5:66190532-66190554 TGTACTGATTTCTTTTCTTTTGG + Intergenic
992118618 5:73566546-73566568 TGTAAAGTTTTCAGGCTTTTTGG + Intronic
992298906 5:75357133-75357155 AGAACTGCTTTCAGTTCTTTTGG - Intronic
992647902 5:78829182-78829204 TTGAATGTTTTCAGTTCTGTAGG - Intronic
992965495 5:81995463-81995485 TCTACTGTTTTCAGTTGTGTAGG - Intronic
993525108 5:88955756-88955778 TGGAATGTTTTAAGTTCTCCTGG - Intergenic
993917324 5:93758916-93758938 TGTATTGTTTTCCTTTGTTTTGG - Intronic
993988873 5:94631732-94631754 AGACATGTTTTCAGTTCTCTTGG + Intronic
994080428 5:95703052-95703074 AGTATTATTTTCTGTTCTTTTGG + Intergenic
994112625 5:96024079-96024101 TGTAGTATTTTCAGTTCATGGGG - Intergenic
994430287 5:99650203-99650225 TGTACTGATTTCATTTCCTTTGG - Intergenic
994436829 5:99746213-99746235 TGTACTGGTTTCCTTTCTTTGGG + Intergenic
994896350 5:105708363-105708385 TGTACTGATTTCAATTCCTTAGG - Intergenic
995139051 5:108713849-108713871 TGAACTGTGTTCTGTTCTTTAGG + Intergenic
995363868 5:111331895-111331917 TATTATGTTTTAAGTTCATTAGG + Intronic
995518796 5:112980806-112980828 TGTTTTGTTTTGAGTTCTTCTGG + Intronic
995618729 5:113998766-113998788 TGTGATGTTCTCAGTCCTCTAGG - Intergenic
995663627 5:114515045-114515067 TATTCTGTTTTCAGTTCTATTGG + Intergenic
995772129 5:115682414-115682436 GTGAATGTTTTCAGTTATTTTGG + Intergenic
995941854 5:117595467-117595489 TTTAATACTTTCAGGTCTTTGGG + Intergenic
995999046 5:118335972-118335994 TGGAATGTTTTGAGTACTATTGG - Intergenic
996040480 5:118804366-118804388 TGTATTGATTTCCTTTCTTTTGG - Intergenic
996103703 5:119473136-119473158 TCTTCTGATTTCAGTTCTTTTGG + Intronic
996117910 5:119638303-119638325 TTTAAAGTTTTCAGTTTTTCCGG + Intergenic
996551736 5:124737630-124737652 TGTGATCATTTCAGTTCTTAAGG + Intronic
996553666 5:124756090-124756112 TTTAATGTTTTCTGTTTATTTGG + Intergenic
996560419 5:124822513-124822535 TATATTGATTTCACTTCTTTTGG - Intergenic
996656483 5:125942999-125943021 TATATTGATTTCAGTTCTTTCGG - Intergenic
997129320 5:131261116-131261138 TGTAATGTTTCCACTTGTTATGG + Intronic
997863280 5:137438896-137438918 AGTAAAGTTTTCAGATCATTTGG + Intronic
998289603 5:140900683-140900705 TATACTGATTTCCGTTCTTTTGG + Intronic
998550470 5:143072410-143072432 TGTAATGATTTCCTTTCCTTTGG - Intronic
998571478 5:143262744-143262766 TTATATGTTTTCAGTTCTCTTGG + Intergenic
998662494 5:144255315-144255337 TGTATTGATTTCAATTATTTTGG + Intronic
998910045 5:146949670-146949692 TGTACTGATTTCCTTTCTTTGGG - Intronic
1000596761 5:163223641-163223663 TGTAATAATCTCAGTACTTTGGG - Intergenic
1000674344 5:164102808-164102830 TATAATGTTTTTAGTTTTCTGGG + Intergenic
1000775945 5:165419911-165419933 TGCAATCCTTTTAGTTCTTTAGG - Intergenic
1000821056 5:165983865-165983887 GTCACTGTTTTCAGTTCTTTTGG + Intergenic
1000933957 5:167285552-167285574 TATACTGTTTTGATTTCTTTTGG + Intronic
1001857624 5:175026515-175026537 GTGAATGTTTTCAGTTCTGTGGG - Intergenic
1001925855 5:175636494-175636516 TGTAATGATTTCTTTTCCTTTGG - Intergenic
1002141394 5:177142418-177142440 TGTTATGTATGCAGTACTTTGGG + Intronic
1002698439 5:181105488-181105510 TGGAATCTTTTCAGTTTTGTCGG + Intergenic
1003665138 6:8103877-8103899 TGTTCTGCTTTCAGTTTTTTAGG - Intergenic
1004015166 6:11725688-11725710 AGCCATGTTTTCAGTTCTTTTGG - Intronic
1004030487 6:11863758-11863780 TATTCTGCTTTCAGTTCTTTTGG + Intergenic
1004574093 6:16876191-16876213 TTACATGTTTTCAGTTCTCTTGG + Intergenic
1004612257 6:17254054-17254076 TATAATGATTTCTTTTCTTTTGG - Intergenic
1004640419 6:17509722-17509744 ACATATGTTTTCAGTTCTTTTGG - Intronic
1004725395 6:18306536-18306558 TGTTAGGTTTTTATTTCTTTGGG - Intergenic
1005559815 6:27027210-27027232 TGACATGTTTTCATTTCTCTTGG + Intergenic
1005846008 6:29779214-29779236 TGATCTGTTTACAGTTCTTTAGG - Intergenic
1006311280 6:33262527-33262549 TGTACTGATTTCCTTTCTTTTGG - Intronic
1006687367 6:35847368-35847390 GCTAATTTTTTCATTTCTTTTGG + Intronic
1006778423 6:36614894-36614916 TGTAATGGATTCAGTCCTGTGGG + Intergenic
1007552106 6:42737934-42737956 TGTACTGATTTCCTTTCTTTTGG - Intergenic
1007646817 6:43389002-43389024 TGAAATGTCTTCCTTTCTTTTGG - Intergenic
1007885566 6:45225820-45225842 TGTTATTTCTTCAGGTCTTTTGG - Intronic
1008227129 6:48935174-48935196 TTTAATCATTTCAGTTTTTTTGG + Intergenic
1008270883 6:49487944-49487966 TGAATTGTTTTCATTTATTTAGG - Intronic
1008289017 6:49689518-49689540 AGTAATATTTTGAGTTGTTTAGG - Intergenic
1008513952 6:52302007-52302029 CATTCTGTTTTCAGTTCTTTTGG + Intergenic
1008732129 6:54495172-54495194 GGAAATGTTTTCATTTATTTGGG + Intergenic
1009042395 6:58194425-58194447 AGTTCTGTTTTTAGTTCTTTGGG + Intergenic
1009580999 6:65533778-65533800 TGTATTTTTTTCAGTTCTAGAGG - Intronic
1009811244 6:68669765-68669787 TGTATTGATTTCCTTTCTTTTGG + Intronic
1009879591 6:69549393-69549415 TCTATTATTTTCTGTTCTTTGGG + Intergenic
1010318862 6:74483536-74483558 TGACATGTTTTCAGCTCTTTTGG + Intergenic
1010480110 6:76340996-76341018 GGTACTGATTTCATTTCTTTTGG - Intergenic
1010481744 6:76363485-76363507 TGTACTGATTTCCTTTCTTTTGG + Intergenic
1010491586 6:76483161-76483183 AATTATATTTTCAGTTCTTTGGG - Intergenic
1010787587 6:80022244-80022266 TGTAATATGTTCTGTTGTTTAGG + Intronic
1010837024 6:80601046-80601068 TATACTGTTTTCTCTTCTTTGGG + Intergenic
1010862498 6:80930594-80930616 CCTAATGTTTTAAGTCCTTTTGG + Intergenic
1010875573 6:81101167-81101189 AGTAATGTTTTACATTCTTTGGG - Intergenic
1011079113 6:83470281-83470303 AGGATTGTTTTCAGTTCTTTTGG + Intergenic
1011138320 6:84124218-84124240 TATAATGATTTCTGTTCCTTTGG - Intergenic
1011322342 6:86109794-86109816 TGTACTGATTTCCTTTCTTTGGG + Intergenic
1012000980 6:93654794-93654816 AGTAATGTTTTCCCTTGTTTTGG + Intergenic
1012181396 6:96157279-96157301 TGTGATGTTTTCAGTGACTTTGG - Intronic
1012212192 6:96533259-96533281 ATGAATGTTTTCATTTCTTTGGG - Intronic
1012529206 6:100214002-100214024 AGTTCTGTTTTAAGTTCTTTGGG - Intergenic
1012579273 6:100845502-100845524 TGTAACCTTTTCAGTTCTTAGGG + Intronic
1012696823 6:102394527-102394549 TATAATGATTTCTTTTCTTTTGG - Intergenic
1013084354 6:106842970-106842992 CGTAAGTTTTTCATTTCTTTGGG + Intergenic
1013257062 6:108397937-108397959 TGTACTGATTTCCTTTCTTTTGG + Intronic
1013259611 6:108428435-108428457 TGTAATGGTTTCTTTTCCTTTGG + Intronic
1013363194 6:109413619-109413641 TATAATGATTTCCTTTCTTTTGG - Intronic
1013419881 6:109957729-109957751 TGTTCTGTTTTAAGTTCTTGAGG - Intergenic
1013571648 6:111432996-111433018 TGTTGTGTTTTCATTTCCTTTGG - Intronic
1014033006 6:116729411-116729433 TGTAATGTTTGCATTTGTATAGG + Intronic
1014081811 6:117295996-117296018 TGTACTGATTTCCTTTCTTTTGG - Intronic
1014294148 6:119597746-119597768 TATAATGATTTCTTTTCTTTTGG + Intergenic
1014349650 6:120324293-120324315 TGTAATATATGCAGTTCTGTTGG - Intergenic
1014402109 6:121002890-121002912 TATAATGATTTCTTTTCTTTTGG - Intergenic
1014549635 6:122775322-122775344 TGTACTCTATTCAGTTCTATTGG - Intergenic
1014918311 6:127181468-127181490 GGTATTGTTTTCAGTTTGTTAGG + Intronic
1015126662 6:129762816-129762838 GGTTATGATTTCATTTCTTTGGG + Intergenic
1015537909 6:134285020-134285042 TGTAATGACTTCTTTTCTTTTGG + Intronic
1017009224 6:150052011-150052033 TTTAAGCTTTTCAGTTCTTAAGG + Intergenic
1017120321 6:151017935-151017957 TGCCATGTTTTCAATTCTTTTGG + Intronic
1017425055 6:154311969-154311991 TATACTGATTTCATTTCTTTTGG - Intronic
1018130529 6:160727931-160727953 TGTTTTGTTTTCAGGTCTTATGG - Intronic
1018211463 6:161486681-161486703 TTTACTATTTCCAGTTCTTTTGG + Intronic
1018453786 6:163933841-163933863 TGTACTGTTTTCATTGATTTTGG - Intergenic
1018891247 6:167984665-167984687 AGAAGTGTTTTCAGTTCTCTCGG - Intergenic
1019328043 7:448395-448417 TGTTATTTATTCATTTCTTTGGG - Intergenic
1019673597 7:2297237-2297259 TGTAATTATTTCTTTTCTTTTGG - Intronic
1020285798 7:6679545-6679567 TTTAAAGTGTTCAGTTGTTTTGG + Intergenic
1020579489 7:9977696-9977718 TGTATTTTTTACAGTTTTTTTGG + Intergenic
1020658304 7:10953309-10953331 TGTAATGATTTCTTTTCCTTTGG + Intergenic
1020664052 7:11017233-11017255 TGTACTGATTTCCTTTCTTTCGG + Intronic
1020694423 7:11395914-11395936 TGTTATGATTTCTGTTCTTTTGG - Intronic
1020725934 7:11814664-11814686 TGTAATTTCTTTAGTTCTCTTGG - Intronic
1020871345 7:13632980-13633002 TGTAATGTTTTTATTTGGTTTGG - Intergenic
1020927323 7:14347449-14347471 GGTATTGATTTCATTTCTTTGGG - Intronic
1021014941 7:15520469-15520491 TGTTATGATTTCCATTCTTTTGG - Intronic
1021477232 7:21076059-21076081 TGTTATATTTTCAGCTTTTTGGG + Intergenic
1022080853 7:27019655-27019677 TATAATGATTTCCTTTCTTTGGG - Intergenic
1022201258 7:28119873-28119895 GGTAATGTTTACAGTTATGTAGG - Intronic
1022268010 7:28777030-28777052 ACAAATATTTTCAGTTCTTTTGG + Intronic
1022724482 7:32968320-32968342 GATTCTGTTTTCAGTTCTTTTGG + Intronic
1023221913 7:37928260-37928282 TGGAATATTTTCAGATCTTTGGG - Intronic
1023285104 7:38610974-38610996 GATTCTGTTTTCAGTTCTTTTGG - Intronic
1023435709 7:40138479-40138501 TGTAATGATTTCTTTTCCTTTGG + Intronic
1023540929 7:41265091-41265113 TGTTATATTTTCAGATTTTTAGG - Intergenic
1024120851 7:46237810-46237832 TTTCATGTGTTCTGTTCTTTTGG - Intergenic
1024188667 7:46982391-46982413 TGTTCTGTTTTCAGTTCCCTTGG + Intergenic
1024276944 7:47685298-47685320 TTTTAGGTTTTCAGCTCTTTTGG + Intergenic
1024310079 7:47961090-47961112 TGTACTGATTTCATTTCCTTTGG - Intronic
1024502582 7:50127971-50127993 TATATTGTTTTCCTTTCTTTTGG - Intronic
1024999725 7:55305531-55305553 TGTAATGATTTCTTTTCCTTTGG - Intergenic
1025049123 7:55719511-55719533 GATTCTGTTTTCAGTTCTTTTGG - Intergenic
1026020633 7:66702467-66702489 ACTCATGTTTTCAGTTCTCTTGG + Intronic
1026234303 7:68512569-68512591 ACTTATGTTTTCATTTCTTTTGG - Intergenic
1026883873 7:73925262-73925284 ACTCATGTTTTCAGTTCTCTTGG + Intergenic
1027533343 7:79364249-79364271 TGTACTGATTTCATTTCCTTTGG - Intronic
1027783095 7:82544658-82544680 TGTGATGTTTTCTGTTCTATAGG - Intergenic
1027820783 7:83041798-83041820 TATAATATTTTCATTTCTTTAGG - Intronic
1027877185 7:83786038-83786060 TGTCATGTTTCCAGGGCTTTGGG + Intergenic
1028142122 7:87286005-87286027 TGTTATGATTTCCATTCTTTTGG + Intergenic
1028381630 7:90206439-90206461 AAAAATGTTTTCAGTTCTCTTGG + Intronic
1028388490 7:90287302-90287324 TATAATGCTTTCATTTCTCTCGG + Intronic
1028612052 7:92722865-92722887 TGTCTTGTTTTTAGTTATTTGGG - Intronic
1029512870 7:101007730-101007752 TGTACTGATTTCCTTTCTTTTGG + Intronic
1029526495 7:101097821-101097843 TGTAAACTCTTCAGTTCCTTTGG + Intergenic
1029839478 7:103346981-103347003 GATCCTGTTTTCAGTTCTTTTGG + Intronic
1030576776 7:111297568-111297590 TGTCATGTTTTCTTTTCTCTTGG - Intronic
1030594627 7:111522791-111522813 TATACTGATTTCAGTTCCTTTGG - Intronic
1031530124 7:122866005-122866027 ATTAATGTTTTTAATTCTTTGGG - Intronic
1031579497 7:123454065-123454087 TATAATGTTTTCTGCTCTTTTGG - Intronic
1031771012 7:125843297-125843319 TGTAATTTTTTCATTTATTCTGG - Intergenic
1032309909 7:130775516-130775538 AGTTAAGTTTTCATTTCTTTGGG + Intergenic
1032963099 7:137063185-137063207 TAGAATGATTTCATTTCTTTAGG - Intergenic
1033549055 7:142429116-142429138 TGCCCTGTTTTCAATTCTTTTGG + Intergenic
1033755171 7:144392722-144392744 TAGAATATTTTCATTTCTTTGGG - Intergenic
1034068132 7:148156248-148156270 TGTTTTGTTTTGAGTTCCTTTGG + Intronic
1034121485 7:148631914-148631936 TGTATTGTTTTCATTTCTCTGGG - Intergenic
1034702326 7:153107304-153107326 TTATATATTTTCAGTTCTTTGGG + Intergenic
1035898221 8:3428711-3428733 TGTACTGATTTCATTTCTGTTGG - Intronic
1037004849 8:13765514-13765536 GGTAGTGATTTCATTTCTTTGGG - Intergenic
1037031711 8:14115043-14115065 TGTAATTTTTTCATTTTTTTTGG - Intronic
1037139805 8:15506349-15506371 AGTAATGTTTTCAGGTTTTATGG - Intronic
1037531710 8:19782406-19782428 TTGACTGTTCTCAGTTCTTTGGG - Intergenic
1037621726 8:20569523-20569545 TATACTGATTTCATTTCTTTTGG + Intergenic
1038368158 8:26958424-26958446 AATAATGTTCTCAGTGCTTTGGG - Intergenic
1038467915 8:27783023-27783045 TGTGATTTTTACAGTTCTGTGGG + Intronic
1038552989 8:28485745-28485767 TGTAATGAAATCATTTCTTTTGG - Intronic
1038662001 8:29505677-29505699 TGTTCTGTTTTAAGTTCTTTGGG + Intergenic
1038871635 8:31501246-31501268 TATAATGATTTCCTTTCTTTTGG + Intergenic
1039100183 8:33933029-33933051 TGTACTGATTTCCTTTCTTTTGG + Intergenic
1039640401 8:39214170-39214192 CGTAATGATTTCCATTCTTTTGG + Intronic
1039679917 8:39721910-39721932 TATAATGATTTCTCTTCTTTTGG - Intronic
1039808646 8:41025319-41025341 TGTCATATTTTCTGTTCCTTTGG - Intergenic
1039935908 8:42045065-42045087 TGTAAACTTTTCATATCTTTGGG + Intronic
1040695396 8:49991445-49991467 TGTTATGTTATCATTTCTCTTGG - Intronic
1040776196 8:51045745-51045767 TATAATGATTTCTTTTCTTTTGG + Intergenic
1041214165 8:55583336-55583358 TATAATGATTTCTTTTCTTTTGG - Intergenic
1041556652 8:59164821-59164843 TATACTGATTTCATTTCTTTTGG + Intergenic
1041556861 8:59167408-59167430 GGTTCTGTTTTCAATTCTTTTGG + Intergenic
1041692185 8:60699408-60699430 TGAAATCATTTCAGTTCTTCTGG - Intronic
1041746971 8:61218158-61218180 TATTATGATTTCATTTCTTTTGG - Intronic
1041747833 8:61228877-61228899 CATACTGTTTTCATTTCTTTCGG + Intronic
1041782644 8:61594593-61594615 TGTATTGTATTCAGCTATTTTGG - Intronic
1042446099 8:68886756-68886778 TCTTATGTTTTCAATTCTCTTGG - Intergenic
1042448012 8:68911183-68911205 TGTAGTGCTTTCAGTTCTGAAGG + Intergenic
1043044437 8:75303340-75303362 TTTAATGTTTACAATTCTTGTGG - Intergenic
1043107930 8:76138432-76138454 TGTAATGTTTTCAGGCATGTTGG - Intergenic
1043244731 8:77982948-77982970 TGTAGTGTTTAGGGTTCTTTTGG + Intergenic
1043281978 8:78479580-78479602 TATACTGATTTCACTTCTTTTGG - Intergenic
1043312678 8:78880730-78880752 TGTAATTTTTAAAGTTTTTTCGG - Intergenic
1043320652 8:78981505-78981527 TGTCATGTTTTTATTTCTTTTGG + Intergenic
1043338386 8:79206159-79206181 TAAACTGTTTTCAGTTTTTTAGG + Intergenic
1043352121 8:79374131-79374153 TGTAATGATTTCATTTCCTTTGG - Intergenic
1043508736 8:80929334-80929356 TCCTATGTTTTCATTTCTTTTGG + Intergenic
1043712765 8:83443087-83443109 TGTATTATTTTCCTTTCTTTTGG + Intergenic
1043949222 8:86289495-86289517 TGTAATGATTTCTTTTCCTTTGG - Intronic
1044262626 8:90145130-90145152 TGTAATGATTTTCTTTCTTTTGG + Intergenic
1044431703 8:92115159-92115181 TGTAATGATTTCCTTTCCTTTGG + Intergenic
1044623619 8:94215149-94215171 TGTGATGTTTTTATTTCTCTTGG - Intronic
1045347458 8:101305973-101305995 ATTAATATTTTCATTTCTTTTGG + Intergenic
1045455172 8:102371085-102371107 TATACTGATTTCAATTCTTTTGG + Intronic
1045471331 8:102514834-102514856 TGCAATGGTGTCAGTTCATTTGG - Intergenic
1045504097 8:102766581-102766603 TGTACTCTTTTCAGTTCTGGAGG + Intergenic
1045583911 8:103509276-103509298 TGTAATCTTTTCAGAACTTCAGG + Intronic
1046107584 8:109684175-109684197 TGGAATGTTTTCAGAACTATTGG + Intronic
1046143415 8:110124389-110124411 TGTAATGATTTCCTTTCTTGTGG + Intergenic
1046850464 8:118966597-118966619 TGTATTGTTTTCAATTCTTTAGG - Intergenic
1047019999 8:120765245-120765267 TGTGAGTTTTTCAGTTTTTTTGG - Intronic
1047269325 8:123340471-123340493 GTTTTTGTTTTCAGTTCTTTGGG - Intronic
1047283578 8:123466705-123466727 GATCTTGTTTTCAGTTCTTTTGG + Intronic
1047283798 8:123468689-123468711 GATCTTGTTTTCAGTTCTTTTGG + Intergenic
1047382863 8:124380080-124380102 TATACTGATTTCATTTCTTTTGG + Intergenic
1047660476 8:127028761-127028783 TGTCATCTTTTCAGTTTTGTTGG + Intergenic
1048340582 8:133535648-133535670 GCTAATGTTTTCACTTTTTTTGG + Intronic
1048663721 8:136636382-136636404 TGTAATGATTTCCTTTGTTTTGG + Intergenic
1048916069 8:139184015-139184037 TGTAATGACTTCAATTCCTTTGG - Intergenic
1049162655 8:141107271-141107293 TGTGATGTCTGCAGTTCTTTTGG + Intergenic
1050047953 9:1568750-1568772 TTTAATATTTGGAGTTCTTTTGG + Intergenic
1050531777 9:6596894-6596916 TGTAATGTTTTCAGTTCTTTTGG - Intronic
1050806735 9:9689969-9689991 TGTATTGATTTCCTTTCTTTTGG + Intronic
1050871354 9:10574226-10574248 TGTATTGTTTTAAGTTTTCTGGG + Intronic
1050979156 9:11987071-11987093 AGTACTGTTTTAACTTCTTTGGG + Intergenic
1051039505 9:12789818-12789840 TGTAATCTTTTCTGCTCTCTGGG - Intronic
1051121233 9:13754699-13754721 TATAATCATTCCAGTTCTTTTGG - Intergenic
1051302555 9:15667756-15667778 TTTAATGTTTTCAGTCTTTCAGG - Intronic
1051417930 9:16862174-16862196 CATAATGTTTTCATTTCTCTTGG - Intronic
1051721073 9:20038060-20038082 TTTCAGGTTTTCAGCTCTTTGGG + Intergenic
1051794910 9:20856074-20856096 TGTACTGATTTCCTTTCTTTTGG + Intronic
1051923268 9:22292807-22292829 TATAATGATTTCCTTTCTTTTGG + Intergenic
1051989046 9:23129220-23129242 TTTAAGGTTTGCAGTTCTTTTGG + Intergenic
1052066790 9:24032015-24032037 ATTAATGTATTCAGATCTTTTGG + Intergenic
1052099495 9:24427698-24427720 TGTACTGATTTCCTTTCTTTAGG + Intergenic
1052169804 9:25379029-25379051 TCTAATGTTTTCAATTTTGTTGG - Intergenic
1052278016 9:26700833-26700855 GGTTATATTTTTAGTTCTTTGGG - Intergenic
1052543795 9:29846311-29846333 AGTTCTGTTTTAAGTTCTTTGGG - Intergenic
1052579968 9:30342546-30342568 AAAAATGATTTCAGTTCTTTTGG + Intergenic
1052636586 9:31114355-31114377 TTTGATGTTTTCAGTGTTTTAGG - Intergenic
1052918487 9:33942953-33942975 TTGCATGCTTTCAGTTCTTTGGG - Intronic
1053155391 9:35774819-35774841 TATAATCTTTTCAGTGTTTTTGG + Intergenic
1053332514 9:37227594-37227616 GGACATGTTTTCAGTTCTCTTGG - Intronic
1053494049 9:38536501-38536523 TGTAAAGATTTAAGGTCTTTTGG + Intergenic
1053784100 9:41639904-41639926 TGTAATGATTTCCTTTCCTTTGG + Intergenic
1054172054 9:61850030-61850052 TGTAATGATTTCCTTTCCTTTGG + Intergenic
1054446916 9:65379053-65379075 TGTAATGATTTCCTTTCCTTTGG + Intergenic
1054665483 9:67730777-67730799 TGTAATGATTTCCTTTCCTTTGG - Intergenic
1054727113 9:68663780-68663802 TGAAAGGTTTTCAGTTCTGATGG + Intergenic
1054910649 9:70452303-70452325 TGGAATGATTTGAGTTCTATGGG - Intergenic
1055005350 9:71499313-71499335 TTTAATGTTTCCTTTTCTTTGGG - Intergenic
1055401285 9:75926953-75926975 AATAATGTTTTAATTTCTTTTGG + Intronic
1055413562 9:76058104-76058126 TGTAATCCTTGCAGTTTTTTGGG - Intronic
1055683658 9:78745246-78745268 TGTAAAGTTTTTGGTTATTTCGG + Intergenic
1055768530 9:79691400-79691422 TGTAATCTTTTCTGTTCTTATGG + Intronic
1055946118 9:81692808-81692830 TGTAATTTTTTAATTTTTTTTGG + Intergenic
1056349982 9:85740562-85740584 TGGAATGTTTTTAGTTCAGTAGG - Intronic
1056410603 9:86322577-86322599 TGTTATATTTTCATTTCCTTTGG - Intronic
1056982670 9:91330317-91330339 TGTAATGTGTTCTTTTATTTGGG - Intronic
1057043292 9:91863365-91863387 TTTTATGTTTTCATTTCTCTTGG - Intronic
1057286820 9:93763366-93763388 AGACATGTTTTCAGCTCTTTTGG - Intergenic
1057301242 9:93885019-93885041 AGTCCTGTTTTCAATTCTTTGGG - Intergenic
1057431469 9:94998378-94998400 TGTAAAGCCTTCAGTTCTGTAGG + Intronic
1057498549 9:95578885-95578907 TGTCATGAATTCAGTTCTTTTGG + Intergenic
1057771897 9:97975556-97975578 ATTTATGTTTTCAATTCTTTTGG + Intergenic
1057783433 9:98069095-98069117 TGTTAAGTTTTCATTTCTTTGGG - Intronic
1057925525 9:99144124-99144146 TTTCATGTTTTCAGTTATCTTGG + Intronic
1058106254 9:100975437-100975459 AGTGCTGTTTTAAGTTCTTTGGG + Intergenic
1058237119 9:102503925-102503947 TTTAATGTTTTCAGTCTGTTGGG + Intergenic
1058382708 9:104395444-104395466 TATACTGTTTTCATTTCCTTTGG + Intergenic
1058755133 9:108076809-108076831 TGTGAGGTTTTCATTTATTTGGG - Intergenic
1059262085 9:112987370-112987392 GGACATGTTTTCAGTTCTCTTGG - Intergenic
1059828064 9:118055971-118055993 CGTACTGATTTCAGTTCCTTTGG + Intergenic
1060383202 9:123196893-123196915 TGTACTGATTTCTTTTCTTTTGG - Intronic
1060576074 9:124695789-124695811 TCTAATGTTTTCAGAAATTTTGG - Intronic
1060746967 9:126143588-126143610 GATCCTGTTTTCAGTTCTTTTGG + Intergenic
1061157131 9:128870137-128870159 ACATATGTTTTCAGTTCTTTTGG - Intronic
1061504117 9:131021302-131021324 TGCATTGTTTTTAGTTTTTTCGG + Intronic
1061713332 9:132502788-132502810 AGTCTTGCTTTCAGTTCTTTTGG + Intronic
1062259289 9:135651897-135651919 TCTACTGATTTCAGGTCTTTAGG - Intergenic
1185518220 X:716725-716747 TTTAAAATTTGCAGTTCTTTTGG + Intergenic
1185919181 X:4070205-4070227 TGTGTTGTTTTCACTTCTCTAGG - Intergenic
1185932447 X:4218251-4218273 AGTTCTGTTTTAAGTTCTTTGGG - Intergenic
1186461284 X:9750510-9750532 GTTCCTGTTTTCAGTTCTTTGGG + Intronic
1186505943 X:10092265-10092287 TGGAATGCATTCAGTGCTTTTGG + Intronic
1186543261 X:10422600-10422622 TTTTATGTTCTCAATTCTTTGGG + Intergenic
1186900308 X:14047858-14047880 TGTACTGATTTCATTTCCTTTGG + Intergenic
1187044778 X:15636204-15636226 CATAATGGTTTCAATTCTTTTGG - Intronic
1187310973 X:18142190-18142212 GGATATGTTTTCAGTTCATTTGG - Intergenic
1188232791 X:27686241-27686263 TGTACTGATTTCCTTTCTTTTGG - Intronic
1188594655 X:31884152-31884174 AATACTGATTTCAGTTCTTTTGG - Intronic
1188674797 X:32925954-32925976 TATAATGATTTCATTTCTTTGGG - Intronic
1189094095 X:38119665-38119687 TATAATGTTTTCATTTCTCTGGG + Intronic
1189445181 X:41074772-41074794 TGTAGAGTTTTTAGATCTTTGGG - Intergenic
1189830542 X:44968480-44968502 TGCAGTGATTTCACTTCTTTGGG + Intronic
1189857178 X:45235111-45235133 TTTAATGTTTTTAGGGCTTTGGG + Intergenic
1189956161 X:46276994-46277016 GGACATGTTTTCAGTTCTTTTGG - Intergenic
1190024032 X:46905566-46905588 TGTATAGTTTTCTGTTTTTTAGG - Intergenic
1190253003 X:48741658-48741680 TTCAATCTTTTCAGTTCTTGGGG - Intergenic
1190642008 X:52488973-52488995 TATACTGCTTTCATTTCTTTGGG + Intergenic
1190645665 X:52523893-52523915 TATACTGCTTTCATTTCTTTGGG - Intergenic
1190853846 X:54273634-54273656 TCTATTGGTTTCTGTTCTTTTGG - Intronic
1190959889 X:55235404-55235426 TGTACTGGTTTCCTTTCTTTTGG + Intronic
1190973191 X:55372640-55372662 TATAATGATTTCCTTTCTTTTGG + Intergenic
1191051085 X:56193476-56193498 TATAATGCTTTCCTTTCTTTTGG - Intergenic
1191051921 X:56202910-56202932 TATACTGATTTCATTTCTTTTGG + Intergenic
1191798352 X:65048397-65048419 GATACTGTTTTCAATTCTTTTGG + Intergenic
1191798451 X:65049978-65050000 TGTTATGTTTTCATTTTTGTTGG + Intergenic
1192085568 X:68093407-68093429 GGACATGTTTTCATTTCTTTGGG + Intronic
1192828381 X:74723725-74723747 ACATATGTTTTCAGTTCTTTTGG - Intergenic
1193019335 X:76774036-76774058 TATAATGATTTCCTTTCTTTTGG - Intergenic
1193255305 X:79341987-79342009 TGTAATTTTTACACTTTTTTGGG - Intergenic
1193345048 X:80396176-80396198 TGTAATAATTTCATTTCCTTTGG + Intronic
1193434977 X:81462057-81462079 TGTACTGATTTCAGTTCCATTGG + Intergenic
1193451378 X:81672417-81672439 TGTAATGATTTCTTTTCCTTTGG - Intergenic
1193497135 X:82228806-82228828 GGTAATTTTTAAAGTTCTTTAGG - Intergenic
1193520381 X:82522883-82522905 TGTAATTTCTTCAGTGGTTTAGG + Intergenic
1193551249 X:82895584-82895606 AGTGATGTTTTCAATTCTATTGG - Intergenic
1193814406 X:86087420-86087442 TGAAATGGTTTCAGTACTATTGG - Intergenic
1193823842 X:86198035-86198057 TGTTGTGATTTCAGTTCTTTTGG - Intronic
1193842409 X:86423153-86423175 TATACTGATTTCATTTCTTTTGG + Intronic
1194072368 X:89341805-89341827 TGTAATGCTTTCAGTTTTTTTGG - Intergenic
1194127140 X:90033180-90033202 TGTCATGTTTTTAGTTTTTATGG + Intergenic
1194325693 X:92514195-92514217 TTTTATGTTTTCATTTCTCTTGG + Intronic
1194431949 X:93819177-93819199 TGTACTGATTTCTTTTCTTTTGG - Intergenic
1194521662 X:94926337-94926359 TGTACTGATTTCCTTTCTTTTGG - Intergenic
1194852228 X:98883563-98883585 TGTTATGATTTCAGTTCTTTTGG - Intergenic
1195027535 X:100892834-100892856 CGTATTGATTTCAGTTCCTTTGG - Intergenic
1195221835 X:102751872-102751894 TAAAATGATTTCAGCTCTTTGGG - Exonic
1195492342 X:105485941-105485963 TATAATGATTTCCTTTCTTTTGG + Intronic
1196109876 X:111934954-111934976 TGTACTGATTTCCTTTCTTTTGG + Intronic
1196119111 X:112029478-112029500 TGTACTGATTTCTTTTCTTTGGG + Intronic
1196306701 X:114111545-114111567 GGTACTCTTTTCAGTTCTTTTGG + Intergenic
1196315085 X:114212912-114212934 TTTAATATTTACAGTTCTTATGG - Intergenic
1196485286 X:116199446-116199468 TATAATGATTTCCTTTCTTTTGG + Intergenic
1196558411 X:117119139-117119161 TCAAATGTTCCCAGTTCTTTGGG + Intergenic
1196713672 X:118790468-118790490 TGACATGTTTTCATTTCTCTTGG + Intronic
1196939933 X:120765388-120765410 TGTAATTTCTTCATTTCTGTGGG - Intergenic
1196961836 X:121011970-121011992 TGTACTGACTTCATTTCTTTTGG + Intergenic
1196999637 X:121424564-121424586 TGTAAAATTTTAAGTTATTTGGG - Intergenic
1197005005 X:121485450-121485472 CTTATTGTTTTCAGGTCTTTTGG - Intergenic
1197026576 X:121757291-121757313 AGTTATATTTTTAGTTCTTTGGG - Intergenic
1197080349 X:122405898-122405920 TGTAAAATTTTCAAATCTTTTGG - Intergenic
1197452181 X:126633091-126633113 TGTACTGATTTCCTTTCTTTGGG + Intergenic
1197625539 X:128798185-128798207 AGTTCTATTTTCAGTTCTTTGGG - Intergenic
1197683575 X:129413670-129413692 TTTTGTGTTTTCAGTTCTCTTGG - Intergenic
1198548585 X:137720097-137720119 TGTATAGTTTTAAGTTCTCTGGG + Intergenic
1198763664 X:140059840-140059862 TAAAATGTTTCTAGTTCTTTAGG + Intergenic
1198776135 X:140180976-140180998 CATAATATTTTCAGTTCTCTTGG - Intergenic
1198885969 X:141337713-141337735 TGTATTGATTTCTTTTCTTTTGG + Intergenic
1199016670 X:142824811-142824833 TCAAATATTTTCATTTCTTTAGG + Intergenic
1199029205 X:142976542-142976564 TATACTGATTTCAGTTCCTTTGG - Intergenic
1199153553 X:144519064-144519086 TGTAATATTTTCATTTATTTTGG + Intergenic
1199164171 X:144650206-144650228 TATACTGATTTCAGTTCTTGTGG - Intergenic
1199211044 X:145210682-145210704 TGTACTGGTTTCCATTCTTTTGG - Intergenic
1199307978 X:146290261-146290283 TGTTATAATTTCATTTCTTTTGG + Intergenic
1199337437 X:146635998-146636020 TCTTAAGTTTTCATTTCTTTTGG - Intergenic
1199387347 X:147238254-147238276 AATACTGATTTCAGTTCTTTTGG - Intergenic
1199498523 X:148483069-148483091 TGGAATGATTTCTTTTCTTTGGG - Intergenic
1199758613 X:150888187-150888209 ACAACTGTTTTCAGTTCTTTGGG - Intronic
1200634422 Y:5633362-5633384 TTTTATGTTTTCATTTCTCTTGG + Intronic
1200726608 Y:6677551-6677573 TGTAATGCTTTCAGTTTTTTTGG - Intergenic
1200727760 Y:6693327-6693349 TGTAATGCTTTCAGTTTTTTTGG - Intergenic
1200783018 Y:7233840-7233862 GGTTATGTTTTAAGTCCTTTGGG - Intergenic
1201352620 Y:13061419-13061441 TATAATGTTTTCTTTTCCTTTGG - Intergenic
1201376592 Y:13329626-13329648 TGTAGTGTTTACAGTTCATTTGG - Intronic
1201385361 Y:13434917-13434939 TGTAATTTTTTATGTTCATTTGG - Intronic
1201450744 Y:14110972-14110994 AGACATGTTTTCAGTTCATTTGG + Intergenic
1201508609 Y:14732867-14732889 TGTAATGTTTCATGTTCTTGAGG - Intronic
1201621637 Y:15965581-15965603 TATACTGTTTTCCTTTCTTTAGG - Intergenic
1202047409 Y:20748794-20748816 GTTTCTGTTTTCAGTTCTTTGGG + Intergenic