ID: 1050531778

View in Genome Browser
Species Human (GRCh38)
Location 9:6596918-6596940
Sequence CTTCTGTGTAAATTTTTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 548
Summary {0: 1, 1: 1, 2: 2, 3: 47, 4: 497}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050531778_1050531779 -10 Left 1050531778 9:6596918-6596940 CCATACAAAAATTTACACAGAAG 0: 1
1: 1
2: 2
3: 47
4: 497
Right 1050531779 9:6596931-6596953 TACACAGAAGTGTTCACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050531778 Original CRISPR CTTCTGTGTAAATTTTTGTA TGG (reversed) Intronic
900912768 1:5613542-5613564 TTTGTGTGCAAGTTTTTGTATGG + Intergenic
901243933 1:7713448-7713470 CTTATGTGAAACTTTTTGTGGGG - Intronic
901419257 1:9139325-9139347 CTAATTTTTAAATTTTTGTAGGG - Intergenic
903061914 1:20674717-20674739 ATTTTGAGTTAATTTTTGTATGG + Intronic
904034976 1:27553897-27553919 CTAATTTTTAAATTTTTGTAGGG - Intronic
905547616 1:38811991-38812013 CTGCTGTGAACATTTGTGTACGG - Intergenic
906181110 1:43819882-43819904 GTTCTGTGTTAATTTGTTTAGGG + Intronic
908507934 1:64824427-64824449 ATGCTGTGTGGATTTTTGTATGG + Intronic
908546041 1:65163070-65163092 TTTGTATGTAAGTTTTTGTATGG + Intronic
908582680 1:65532512-65532534 CTTCTGTACAACTTTTTGTGTGG - Intronic
910290500 1:85595964-85595986 CATATGTGTAAATTTTTCAAAGG - Intergenic
910900694 1:92117409-92117431 CTTCTTTTTAAATTTTGTTAGGG + Intronic
911112671 1:94208001-94208023 CATCTGGCTAATTTTTTGTAGGG + Intronic
911239826 1:95452859-95452881 CTTTTGTGTTAATTCTTTTAGGG - Intergenic
911548361 1:99248885-99248907 CTTTTGGCTAAGTTTTTGTATGG + Intergenic
912628459 1:111226372-111226394 CTTCTGTGTCTATTCTTGTAAGG + Intronic
912731091 1:112106314-112106336 CTTCTGTGACAAAATTTGTAGGG + Intergenic
915727300 1:158026876-158026898 CTTCTGTGTTGACTGTTGTAGGG - Intronic
918745799 1:188197526-188197548 CTTTTGTGTACATTTTAGTTGGG + Intergenic
918782911 1:188726757-188726779 ATTCTCTGTATATTTTTGAAAGG + Intergenic
919138185 1:193536870-193536892 ATTCTGTGTATATATTTTTAAGG - Intergenic
920393531 1:205626830-205626852 GTCCTGTGTAAGTTTTTGTATGG - Intronic
920546828 1:206825142-206825164 CATATGTGTACATTTTTGTGGGG + Intronic
920734561 1:208519342-208519364 GTTCAGTGTAAATATTGGTATGG + Intergenic
921168195 1:212522479-212522501 CCTTTCTGTTAATTTTTGTATGG + Intergenic
921428179 1:215029877-215029899 CCTCTGTGTAGGTTTTTGTGTGG + Intronic
922458918 1:225799770-225799792 CTTCTGAATAGAATTTTGTATGG + Intergenic
923587037 1:235282587-235282609 CATCTCTGAAAATTCTTGTAGGG - Intronic
923970297 1:239194627-239194649 CTTCTATGTGTATTTTGGTAAGG + Intergenic
924187693 1:241512628-241512650 CTTATGTGTTAGTTTTTGGATGG + Intronic
924288358 1:242511300-242511322 ATTCTTTGTAATTTTTTGTAAGG - Intronic
924583773 1:245344295-245344317 CTTCTGTGTAAGATTTTGTTTGG + Intronic
1064472955 10:15655917-15655939 ATTCTGTTTTATTTTTTGTAGGG - Intronic
1064823009 10:19360705-19360727 CTGCTGTGTCAATATTTATAAGG - Intronic
1064950831 10:20848307-20848329 ATTAAATGTAAATTTTTGTAGGG + Intronic
1066108255 10:32174569-32174591 CTTGTGTATAAATTTCTGTGTGG - Intergenic
1066607784 10:37199358-37199380 TTTCTTTGTAAATTTTTATTTGG - Intronic
1068263215 10:54611226-54611248 CTTCTCTGTTAAATTTTGCAAGG - Intronic
1068402038 10:56540564-56540586 CTTCTGTATAAATTTATTTCTGG + Intergenic
1068431893 10:56943782-56943804 CTTCTGTTGGAATTTTTGCAAGG - Intergenic
1071066782 10:81645040-81645062 CTTCTGTGTTAATCTTGCTAAGG + Intergenic
1071428941 10:85589396-85589418 CTTTTGAGTTAATTTTTGTGAGG - Intergenic
1072571222 10:96658929-96658951 CTACTGTGTTAGTTTTTGCAGGG - Intronic
1073526357 10:104186074-104186096 CTGCTTTGTACTTTTTTGTATGG + Exonic
1073676464 10:105652539-105652561 TTTTTTTTTAAATTTTTGTAAGG - Intergenic
1077921574 11:6645951-6645973 CTTCTGTGTATATATGTGAAAGG - Intronic
1078609544 11:12808498-12808520 CTACTGTCTCAATTTTTGCAAGG - Intronic
1078960238 11:16258237-16258259 TTTCTGTGTAGGTTTTTGTGTGG - Intronic
1080015672 11:27504290-27504312 CTTCACTGGAAATTTTTATATGG - Intronic
1080714372 11:34784422-34784444 CTTATGTGTACATATTTGCAGGG + Intergenic
1081344653 11:41968651-41968673 CATCAATATAAATTTTTGTATGG + Intergenic
1081425880 11:42926095-42926117 CTTCTGAGCATATTTTTATATGG - Intergenic
1081937569 11:46916081-46916103 TTTCTGTGCACATGTTTGTAAGG - Intronic
1082205209 11:49425282-49425304 CTTCTGTGTATAGCTTTGAAAGG - Intergenic
1082601099 11:55155844-55155866 CTTCTGTCTAGTTTTTTGTCAGG + Intergenic
1082629907 11:55529838-55529860 CTTTTTTGTATTTTTTTGTAGGG - Intergenic
1082684961 11:56226535-56226557 CTTCTTTATTAATTTTTGTGTGG - Intergenic
1082967618 11:58983564-58983586 CTTCTTTGCCAATATTTGTAAGG + Intronic
1082973328 11:59046974-59046996 CTTCTTTGCCAATATTTGTATGG + Intergenic
1082977737 11:59090750-59090772 CTTCTTTGCCAATATTTGTATGG + Intergenic
1084764154 11:71296850-71296872 CTTGTGTGCAGATTTTTGTGTGG - Intergenic
1084896407 11:72273656-72273678 ATTGTGTGTAAGTTTTTGTGTGG + Intergenic
1085171664 11:74454681-74454703 CCTCTGTGGAAATACTTGTAAGG + Intergenic
1085698180 11:78723187-78723209 CTTCTGTGTGACTTTGGGTAAGG - Intronic
1085865212 11:80282656-80282678 CTTCTGTGTGTACTTTTCTATGG + Intergenic
1086649890 11:89275254-89275276 CTTCTGTGTATAGCTTTGAAAGG + Intronic
1087129505 11:94656131-94656153 CTTCTGTATAACATTTTATATGG - Intergenic
1088079840 11:105898248-105898270 CTTTTGTATTAATTTTTATAGGG + Exonic
1089550392 11:119270959-119270981 CTTATGTAGAAATTTTTGTGTGG + Intronic
1089826989 11:121286926-121286948 ATTCTGTGTTACTTTTTGTGTGG - Intergenic
1090786057 11:130048719-130048741 TTTCTTTTTTAATTTTTGTAGGG - Intergenic
1091109280 11:132950657-132950679 CTGCTGTGTGCATTTTTGGAAGG + Intronic
1092082283 12:5726315-5726337 GTTTTGTGTAAATTTTAGTGGGG - Intronic
1094659146 12:32449685-32449707 CTTCTTTGTAATATTTTGTGGGG + Intronic
1094885565 12:34866036-34866058 CTTCTGTGTAACTTTATATGAGG - Intergenic
1094897857 12:35066104-35066126 CTTCTGTGTAACTTTATATGAGG - Intergenic
1094903072 12:35150000-35150022 CTTCTGTGTAAAATTATATGAGG - Intergenic
1094903405 12:35155433-35155455 CTTCTGTGTAACATTATGTGAGG - Intergenic
1094905719 12:35192796-35192818 CTTCTGTGTAAAATTATATGAGG - Intergenic
1094906674 12:35208085-35208107 CTTCTGTGTAAAATTATATGAGG - Intergenic
1094923538 12:35481524-35481546 CTTCTGTGTAAAATTATATGAGG - Intergenic
1094925337 12:35510395-35510417 CTTCTGTGTAAAATTATATGAGG - Intergenic
1094927935 12:35552672-35552694 CTTCTGTGTAAAATTATATGAGG - Intergenic
1094929821 12:35582907-35582929 CTTCTGTGTAACATTTTATGAGG - Intergenic
1094931302 12:35607023-35607045 CTTCTGTGTAAAATTATATGAGG - Intergenic
1094938545 12:35724516-35724538 CTTCTGTGTAAAATTATATGAGG - Intergenic
1094944053 12:35813856-35813878 CTTCTGTGTAACATTATGTGAGG - Intergenic
1094945927 12:35844084-35844106 CTTCTGTGTAAAATTATATGAGG - Intergenic
1094946388 12:35851555-35851577 CTTCTGTGTAAAATTATATGAGG - Intergenic
1094951495 12:35934792-35934814 CTTCTGTGTAAAATTATATGAGG - Intergenic
1094955280 12:35995592-35995614 CTTCTGTGTAAAATTATATGAGG - Intergenic
1094959542 12:36064553-36064575 CTTCTGTGTAACATTATGTGAGG - Intergenic
1094965585 12:36162389-36162411 CTTCTGTGTAACATTATGTGAGG - Intergenic
1094966515 12:36177341-36177363 CTTCTGTGTAACTTTATATGAGG - Intergenic
1094967543 12:36193649-36193671 CTTCTGTGTAACATTATGTGAGG - Intergenic
1094970851 12:36246973-36246995 CTTCTGTGTAAAATTATATGAGG - Intergenic
1094971266 12:36253766-36253788 CTTCTGTGTAAAATTATATGAGG - Intergenic
1094972959 12:36280951-36280973 CTTCTGTGTAACATTTTATGAGG - Intergenic
1094982208 12:36430420-36430442 CTTCTGTGTAAAATTATATGAGG - Intergenic
1094983370 12:36449445-36449467 CTTCTGTGTAAAATTATATGAGG - Intergenic
1094988306 12:36529303-36529325 CTTCTGTGTAAAATTATATGAGG - Intergenic
1094995733 12:36649208-36649230 CTTCTGTGTAAAATTATATGAGG - Intergenic
1095005667 12:36810291-36810313 CTTCTGTGTAACATTATGTGAGG - Intergenic
1095009126 12:36866325-36866347 CTTCTGTGTAAAATTATATGAGG - Intergenic
1095028082 12:37172831-37172853 CTTCTGTGTAACATTATGTGAGG - Intergenic
1095383432 12:41621666-41621688 CTTGTCTGTAAATTATTGCAGGG - Intergenic
1095501310 12:42842001-42842023 ATTCTATGTAAATTTTGATAAGG + Intergenic
1096190702 12:49616414-49616436 CTTCTGTATAGATTTATGTGTGG - Intronic
1097793243 12:63837307-63837329 CTTCTGAGTAGATTTGTGCAGGG - Intergenic
1098257394 12:68630847-68630869 ATTTTGTGTATTTTTTTGTAGGG + Intronic
1098269901 12:68759799-68759821 ACTCTGAGTTAATTTTTGTAAGG - Intronic
1098455094 12:70663783-70663805 TTTCTATGTAAATGTATGTATGG - Intronic
1098522434 12:71448684-71448706 CTTCTATGGAAATTTTTATTTGG - Intronic
1098827325 12:75312961-75312983 CTTTTGTGTTAAGTATTGTATGG - Intronic
1099451211 12:82809417-82809439 CCTCTGGGTACAGTTTTGTAGGG + Intronic
1099779809 12:87179854-87179876 ATACTGTGTAAATTTTTATGTGG - Intergenic
1099798214 12:87424404-87424426 CTTCTGCCTAAACATTTGTATGG - Intergenic
1099895959 12:88646953-88646975 CTTGTGTATAAATCTTTGTGTGG + Intergenic
1099934200 12:89106184-89106206 CTTCTGTCTAAATTTTATTATGG - Intergenic
1100441812 12:94624310-94624332 CTTCTGTGTAAGTTTTTGTGGGG - Intronic
1102271900 12:111544129-111544151 CATGTGTGTAAATTTTTCTAGGG + Intronic
1103563187 12:121803364-121803386 CTTCTGTTTTTATTTTTGGAGGG - Intronic
1103711965 12:122919336-122919358 CTGATTTTTAAATTTTTGTAGGG + Intergenic
1103986348 12:124769954-124769976 CTTCTGTGTTGATTGTTGTGGGG + Intergenic
1105630625 13:22161723-22161745 TTTGTGTATAATTTTTTGTATGG + Intergenic
1105965677 13:25382394-25382416 CTTCTGTGCAGGTTTTTGTGTGG + Intronic
1107185183 13:37509464-37509486 CTCCTGTTTAAATTTGTCTAAGG - Intergenic
1108468104 13:50739273-50739295 CTTCTGTGTAAATTTCATTGTGG + Intronic
1109002755 13:56827242-56827264 CTTCAGTTTAAATTTTTGCTTGG + Intergenic
1109369530 13:61403974-61403996 GTTTTGTGTAAATTTTTTTAAGG - Intergenic
1109568421 13:64151667-64151689 TTTCAATGTAATTTTTTGTATGG - Intergenic
1110212435 13:72989232-72989254 TTTGTGTGTAAATTTTTGTGTGG - Intronic
1110291781 13:73816365-73816387 CTTAAGTGTAAATTTTTTTCAGG - Intronic
1110802865 13:79720472-79720494 TTTCTGTATAAGTCTTTGTATGG + Intergenic
1111455079 13:88471724-88471746 ATTTTGTCTAAATTTCTGTAGGG - Intergenic
1111538858 13:89643608-89643630 TTTCTGGATAAATTTATGTAAGG - Intergenic
1111766537 13:92537914-92537936 CTATTGTGGAAATTTTTGAAAGG + Intronic
1111779590 13:92705373-92705395 ATTCTGAGTAAGTTTTTATAGGG + Intronic
1112330429 13:98473418-98473440 CATCTGTGTAGATTTTGGCAAGG - Intronic
1113773758 13:112930225-112930247 CTTATGTGCAGGTTTTTGTATGG - Intronic
1114272674 14:21112366-21112388 CTTGGGTGGAACTTTTTGTATGG - Intergenic
1115148865 14:30260034-30260056 CTTCTCTGAAAAGTGTTGTATGG - Intergenic
1115426432 14:33265355-33265377 CTGCTCTGTAAAATTTTCTAAGG + Intronic
1115488255 14:33933759-33933781 CTTCTGTGCCAATTTGTGCACGG + Intronic
1115561996 14:34590782-34590804 TTTCTATATAACTTTTTGTACGG - Intronic
1116617834 14:47161471-47161493 CTAATATGTAAATATTTGTATGG - Intronic
1116700279 14:48232357-48232379 CTGCTGTGGAATTTTTTATAAGG - Intergenic
1117541027 14:56746637-56746659 CTACTTTGTAGATTTGTGTAAGG + Intergenic
1118667704 14:68088180-68088202 CTTTGGTATAAGTTTTTGTAAGG + Intronic
1119176535 14:72572324-72572346 CTTGTGTTCAAATTTTTGTATGG - Intergenic
1119550604 14:75510231-75510253 ATTTTGAGTTAATTTTTGTATGG - Intergenic
1119941725 14:78648400-78648422 CTTTTATGTAATTTATTGTATGG - Intronic
1120413296 14:84185795-84185817 TTTATGTGTAAGTTTTTGTGTGG + Intergenic
1120418379 14:84249739-84249761 CTTCTGTGTAAATTTTAACCTGG + Intergenic
1120656765 14:87199525-87199547 CTTCTTTGTGATTTTTTTTAAGG - Intergenic
1121144200 14:91569376-91569398 CTTTTTTGTAAATTCCTGTAAGG - Intergenic
1121159371 14:91722218-91722240 TTTGTGTGAAAATTTTTGTGTGG - Intronic
1121898070 14:97667138-97667160 CATGTGTGTACATGTTTGTATGG + Intergenic
1122520825 14:102342369-102342391 CTGCTGTCTACATTTTTCTATGG + Intronic
1122670183 14:103365794-103365816 TTTCTTTTTAAATTGTTGTAAGG + Intergenic
1124434270 15:29634482-29634504 CTTCTGTGTTGATTTTTGTGGGG - Intergenic
1124546288 15:30630273-30630295 CTTTTGTGTAAGTATTTATAAGG + Intronic
1124779815 15:32619677-32619699 CTTTTGTGTAAGTATTTATAAGG + Intronic
1125095600 15:35847274-35847296 CTTCTGTGGAAATTTTTTACTGG - Intergenic
1125431666 15:39601579-39601601 CTTGTGTACAAGTTTTTGTATGG - Intronic
1125953095 15:43770601-43770623 CGTCTGTGTATATATTTGTGGGG - Intronic
1126321238 15:47426083-47426105 CTTTTGTGTGAATTTTTGATAGG + Intronic
1126386734 15:48100890-48100912 TTTTTCTGGAAATTTTTGTAGGG - Intergenic
1126981400 15:54248099-54248121 CTACTTTCTAAATTTATGTAAGG + Intronic
1127442723 15:59027070-59027092 CTTCTTTGTAAATTAATGTATGG + Intronic
1127580171 15:60331140-60331162 TTGCTGTGCAAATTTTTGTGGGG - Intergenic
1128035610 15:64522866-64522888 TTTCTGTGTAATTTTCTATATGG + Intronic
1129024235 15:72554178-72554200 CTTGTGTACAAGTTTTTGTATGG + Intronic
1129354497 15:74980618-74980640 CTTCTGTGTCCATATTTCTATGG - Intronic
1129520839 15:76185087-76185109 CTTCTGTGTGGATTTCTGTGGGG + Intronic
1129647790 15:77453602-77453624 TTTGTGTATAAATTTTTGTGTGG - Intronic
1130180473 15:81621883-81621905 CTTGTGTGTAGGTTTTTGTGTGG + Intergenic
1131040400 15:89259943-89259965 TTTGTGTATAAATTTTTGTGCGG + Intronic
1131324970 15:91434095-91434117 TTTCTGTGTAAGCATTTGTATGG - Intergenic
1132027949 15:98418914-98418936 CTTGTGTGTAATTTTTTTTTCGG - Intergenic
1133258009 16:4530021-4530043 CTTCTGTGTACAGGTATGTATGG - Intronic
1133608068 16:7407563-7407585 TTCCTGTGTTAGTTTTTGTAGGG + Intronic
1133919922 16:10142892-10142914 GTTCTGTGTAAATTATTATGTGG - Intronic
1136586158 16:31186427-31186449 CTTCTGGGTAAATTGGGGTAGGG + Intronic
1137920425 16:52482326-52482348 CATCTTTTTAAATGTTTGTAAGG - Intronic
1137987699 16:53124061-53124083 TTTGTATGTAAGTTTTTGTATGG + Intronic
1138326834 16:56179679-56179701 GTTTTGAGTTAATTTTTGTATGG + Intergenic
1139130705 16:64140939-64140961 TTTGTGTGTAGGTTTTTGTATGG - Intergenic
1140764297 16:78141529-78141551 CATTTGTGTACAATTTTGTAGGG + Intronic
1141947527 16:87320838-87320860 CATCTGTGTGATTTTTTGTGTGG - Intronic
1144112004 17:12044577-12044599 CTTCTATGTTGATTGTTGTATGG - Intronic
1144299690 17:13911674-13911696 TTTTTGTGTAAGTTTTTGTTTGG - Intergenic
1144333067 17:14241762-14241784 CATCTGTGTATTTTATTGTATGG - Intergenic
1150082772 17:62255411-62255433 CTTCTGTTTAAAATTTTATTTGG - Intergenic
1150272203 17:63873744-63873766 TTTCTGTGTACATTTATGCATGG + Exonic
1150275752 17:63896641-63896663 TTTCTGTGTACATTTATGCATGG + Exonic
1150279168 17:63918905-63918927 TTTCTGTGTACATTTATGCATGG + Intergenic
1150335570 17:64328128-64328150 CTTCTGGGTAAAGTTCTGTCTGG + Intronic
1151192577 17:72409141-72409163 CTTCTGTGTTGATTGTTGTGGGG - Intergenic
1151738512 17:75962372-75962394 ATTCTGTGTGAATTTTTGCTAGG + Intronic
1152175870 17:78786804-78786826 CTTCTGTGAAGATTGTTGTGAGG + Intergenic
1153594169 18:6707065-6707087 CTTCTTTGTCTAGTTTTGTAAGG + Intergenic
1155481870 18:26297800-26297822 CTTGTGTCTATATCTTTGTATGG + Intronic
1158272396 18:55730678-55730700 CTTCAATATAAATATTTGTAAGG + Intergenic
1158901226 18:61963536-61963558 GTTTTGTGGAATTTTTTGTAAGG - Intergenic
1159178902 18:64875270-64875292 TTTCTGTTTAAATCTTTTTATGG - Intergenic
1159642456 18:70879386-70879408 CTTCTCTGTAAATTACTGTTTGG - Intergenic
1159709310 18:71734811-71734833 TTTCTGTGTATATTTTTCTAGGG - Intronic
1159955427 18:74515462-74515484 CTTCTGTGTACAGTGTTTTAGGG + Intronic
1160245317 18:77154279-77154301 ATGCTTTGTAAATTTTTCTATGG + Intergenic
1161861733 19:6802957-6802979 CTTGAGTGTAAGTTTTTGTGTGG - Intronic
1164024386 19:21337951-21337973 TTTCTGTGTAAATGTTTAAATGG + Intergenic
1164519078 19:28963754-28963776 CTTCTGTGTTGATTATTGTGTGG + Intergenic
1164796529 19:31038034-31038056 CTTCTGTGTAAATTGTACTGAGG + Intergenic
1166050801 19:40257674-40257696 TTTGTGTGTAAGTTTTTGTGTGG - Intronic
1166155286 19:40906775-40906797 TTTCTGTGTAAGATTTTGTGTGG + Intergenic
1166290915 19:41862905-41862927 CTGTTGTGTATATTTTTGTTGGG + Intronic
925391698 2:3499554-3499576 CTTCTGTGTGTTTTTCTGTAGGG - Intronic
925868167 2:8246979-8247001 CCTCAGTGTAAATGTTTGCAAGG - Intergenic
926224615 2:10958128-10958150 CTTCTGTGTAAAGTCTTGGAAGG - Intergenic
926584205 2:14668245-14668267 CTTCTTTGTAAAGTTTAATAAGG + Intergenic
928798011 2:35048076-35048098 CATCTGTCTGAATTTTTGGAAGG - Intergenic
929174895 2:38966528-38966550 CATCTGTGGAAAGTTTTCTAAGG + Intronic
929946094 2:46373307-46373329 TTTGTGTATAAATCTTTGTATGG - Intronic
930316273 2:49800408-49800430 CTTCTGTTTTAACTTTTATAGGG + Intergenic
931175808 2:59853336-59853358 CTTCTGTGTGAGTTTTTGTTTGG + Intergenic
931878821 2:66544377-66544399 CTTCTTTGTGAATTTTTGGCTGG + Intronic
932097214 2:68861828-68861850 CTGATGTGTAAATTTTGGTCCGG - Intergenic
932256487 2:70292275-70292297 CTTCTATGTATATTTTAGTTAGG - Intronic
933782004 2:85809120-85809142 ATTTTGAGTTAATTTTTGTATGG - Intergenic
935119394 2:100169239-100169261 CTTCTGTACAGATTTTTGTGTGG + Intergenic
935889443 2:107660037-107660059 CTTCTCTTTGAATCTTTGTATGG + Intergenic
936979971 2:118255304-118255326 ATTCTGTGTAATTTTTTAAATGG - Intergenic
937746917 2:125425153-125425175 ATTCTGTGTAAATATATGTCTGG - Intergenic
938255180 2:129852990-129853012 CTTCTTTTTAAATTTTTTTTTGG - Intergenic
939497681 2:142943332-142943354 CTTCTTTTTAAAATTTTTTATGG - Intronic
940572232 2:155452450-155452472 GTTCTGTGTAAATTATTAAATGG + Intergenic
940588354 2:155686332-155686354 TTCCTGTATACATTTTTGTATGG + Intergenic
940623868 2:156148600-156148622 TTTTTGTGAAAATGTTTGTAGGG - Intergenic
941161461 2:162040236-162040258 TTTGTGTGTAGATTTTTGTGTGG - Intronic
941191447 2:162388712-162388734 CTCCTGTGAAAATTATTGAAGGG - Intronic
941495241 2:166192331-166192353 CTTCTGGGTAAAAATTTGTAAGG + Intergenic
941580007 2:167284357-167284379 CTTTTGTGCATATTTCTGTATGG - Intergenic
941738500 2:169007331-169007353 ACTTTGAGTAAATTTTTGTAGGG - Intronic
942075680 2:172355297-172355319 CATTTGTGAAAATTTGTGTATGG + Intergenic
942435208 2:175964247-175964269 CTTCTGTGTAAATTTATATTTGG - Intronic
942768444 2:179485746-179485768 CTGCTGTGTTATTTCTTGTAGGG + Intronic
942977317 2:182033743-182033765 CTTCTTAGAAAATTTTTGAAGGG - Intronic
943052113 2:182926669-182926691 CTTCTCTGCAAATTTTAGAAAGG + Intronic
943059241 2:183021167-183021189 TTTATGTGAAAGTTTTTGTATGG - Intronic
943072496 2:183156850-183156872 CTTCTTTATAAAGTTCTGTATGG - Intronic
943153406 2:184143142-184143164 CTTCAGTTTATATTTTTGTTAGG - Intergenic
943198368 2:184785547-184785569 GTTCTATGTTAACTTTTGTATGG + Intronic
943387432 2:187219606-187219628 CTTGTGTGTAAATACTTTTATGG + Intergenic
943708754 2:191065354-191065376 TTTCTGTGTTAATTTTTCTTAGG + Intronic
943840141 2:192570076-192570098 GTTCTATGTAGATTTTTTTATGG + Intergenic
943930439 2:193844330-193844352 CTTCTGTGTAAATAGCTCTAAGG - Intergenic
943991706 2:194702613-194702635 CTTCAGTGTAAATTTTTGTAAGG + Intergenic
944261147 2:197678749-197678771 CTACTGTGAAGATTTTTCTAAGG + Intergenic
945545317 2:211143038-211143060 TTTCTGTGCCAATTTTTGGAGGG + Intergenic
946524853 2:220507407-220507429 CTTCTGTGTAATATATTGTTTGG - Intergenic
946986749 2:225282060-225282082 TTTTTGTCTAAATTTTGGTATGG - Intergenic
947699062 2:232217333-232217355 CTTCTGTGTTGATTGTTGCAGGG - Intronic
947757764 2:232580511-232580533 CTTCTGTGTAAATGGGGGTAGGG - Intronic
947913211 2:233815546-233815568 ATTTTGAGTTAATTTTTGTATGG + Intronic
948222325 2:236281401-236281423 CTTCTATGTCTATTTTTTTAGGG - Intergenic
1168885963 20:1256021-1256043 CATTTGTGTACATTTTTGTCTGG + Intronic
1169740406 20:8887747-8887769 CTTCTGTGTCCAGTTTTGTTAGG + Intronic
1169962216 20:11173831-11173853 CTTCTATGAACATTCTTGTATGG - Intergenic
1170175370 20:13463017-13463039 ATTCCATGTAAATTTTTGGATGG - Intronic
1170225359 20:13986092-13986114 TTTATGTGTAAGTTTTTGTATGG + Intronic
1170406855 20:16047162-16047184 CTTCTGTGTAAATATTGCTGTGG - Intronic
1170712451 20:18804126-18804148 CTTGTGTGCAAAATTTTGTGTGG - Intergenic
1171938329 20:31298312-31298334 GTTCTATGTAAATTTTAGAATGG - Intergenic
1172087268 20:32396442-32396464 TTTCTGTGTTTATTTTTGTAAGG + Intronic
1172417890 20:34786809-34786831 ATTTTGAGTTAATTTTTGTAAGG - Intronic
1173683601 20:44906773-44906795 ATTATGTGTAACTTTTTGGAAGG + Exonic
1173734584 20:45350174-45350196 CTTATGTATAAATCTTTCTAAGG + Intergenic
1173890153 20:46501466-46501488 CTCCTGTGTGAATTCTTCTATGG + Exonic
1174466522 20:50721879-50721901 TTTCTGTGTCTATTTTTATAAGG - Intergenic
1174479802 20:50823016-50823038 TTTGTGTGTGAATTTTTGTGTGG - Intronic
1175040672 20:56047340-56047362 CTTCTGTGTGAACTTTTGGCTGG - Intergenic
1175866662 20:62182261-62182283 CTTCTTTGTACAGTTTTGAAGGG - Exonic
1177220153 21:18182028-18182050 TTTGTGTGTACATTTTTGTGTGG + Intronic
1177413517 21:20763518-20763540 CTTCTTTTTAAAGTTTTTTAAGG - Intergenic
1178046420 21:28699510-28699532 CTTCTTGTTAAATTTTTGTTTGG - Intergenic
1178478786 21:32961027-32961049 CTTCTGGGTTCATTTTTGTTTGG + Intergenic
1179053805 21:37913902-37913924 CTTCTCTTTAACTTTTTGTTGGG - Intronic
1179126698 21:38597381-38597403 CGTGTGTGTACATTTATGTATGG + Intronic
1179346546 21:40563061-40563083 CTTCTGTGTAAGCTTTTCTTAGG - Intronic
1181603224 22:23964684-23964706 CTTCTGTGTGGAACTTTGTATGG + Intergenic
1181605290 22:23976623-23976645 CTTCTGTGTGGAACTTTGTATGG - Intronic
1181862891 22:25833156-25833178 ATTCTGTGTAAATTGTTCTGAGG + Intronic
1181891404 22:26066822-26066844 CTTCTGTGTAAATAATTATCTGG + Intergenic
1182025814 22:27118185-27118207 TTTTTGTGCAAATTTTTGTGTGG - Intergenic
1182919816 22:34069031-34069053 CTACGGTGTAAAATTTTGCAGGG - Intergenic
949167294 3:958156-958178 CTTTTATGTGCATTTTTGTAGGG - Intergenic
949253448 3:2016340-2016362 CTTCTGTGTATTTTTTTTTCTGG - Intergenic
949595474 3:5539799-5539821 ATTCTGTGTAAATTCATATAGGG + Intergenic
949756495 3:7417126-7417148 CTTCTATTTCCATTTTTGTAAGG - Intronic
953190244 3:40679260-40679282 CTTCTGGGCAAACATTTGTATGG - Intergenic
954189789 3:48950082-48950104 CTTTTGAGTTAATTTTTGTGTGG + Intronic
954667166 3:52261935-52261957 CATATGTGTACATTTTTGTGTGG - Intronic
955946582 3:64200424-64200446 CTTATGTATAATTTTTTGTGTGG + Intronic
956082867 3:65578333-65578355 CTTGTGTGCAAATGTTGGTAGGG - Intronic
956210467 3:66796479-66796501 CTTATGTGCAAGTTTTTATATGG - Intergenic
956370018 3:68549245-68549267 CTTCTGTGTTGATTGTTGTATGG - Intergenic
956917335 3:73885963-73885985 CTTGAGTGTCAATTTTTGAAAGG - Intergenic
957208198 3:77226485-77226507 CTTCTGTTCAAATTTTAGCATGG - Intronic
957443546 3:80285427-80285449 CTTCTTTGTAGATTTTTGCCTGG + Intergenic
957494515 3:80974471-80974493 CTTTTTTGTACTTTTTTGTATGG - Intergenic
957577464 3:82028229-82028251 CTTCTCACTAAATTTTTGTTTGG - Intergenic
957657552 3:83100482-83100504 CTTCTGTATATATTTTTGTTTGG - Intergenic
957876293 3:86150613-86150635 CTTCTGTGTCTTTTCTTGTATGG + Intergenic
959398036 3:105866645-105866667 TTTCTGAGTAAATCTCTGTAAGG + Intronic
959502765 3:107125378-107125400 CTGGATTGTAAATTTTTGTAGGG + Intergenic
959737000 3:109670664-109670686 ATTCTGAGTAAATTATTGCAAGG + Intergenic
960088844 3:113618386-113618408 CTCATGTGTAAGTTTTTGTGTGG + Intronic
960674583 3:120181944-120181966 CCTTTGTGTAAATTTTTTGAAGG - Intronic
960912560 3:122663856-122663878 CTTTTATGTGCATTTTTGTAGGG + Intergenic
961927170 3:130493281-130493303 CTTCTGTCTATATCCTTGTATGG - Intergenic
962401220 3:135060487-135060509 TTTATGTATAACTTTTTGTAAGG + Intronic
962647202 3:137452042-137452064 CTTCTCTGAAAGTTTTTGTGTGG + Intergenic
963001583 3:140686677-140686699 CTCCTGAGTAAAATTTGGTAAGG + Intronic
963170261 3:142243131-142243153 CTTTTGTGTAATTTGTTGAAAGG + Intergenic
963402710 3:144821479-144821501 CAGCTGTATAAATTTTTGAAGGG + Intergenic
963404575 3:144845566-144845588 CTTTACTGTAAATTTTTGAATGG + Intergenic
963457994 3:145571820-145571842 ACTCTGTGTAAATTATTGTATGG - Intergenic
963731460 3:148977590-148977612 CTTATGTGCAGGTTTTTGTACGG + Intergenic
963892055 3:150647095-150647117 CTTTTGTGGTTATTTTTGTAAGG - Intergenic
964426737 3:156561859-156561881 CCTCTGTGCAAATTTTTGCCTGG - Intergenic
964554875 3:157926011-157926033 CTCCTGCCTCAATTTTTGTATGG + Intergenic
964661840 3:159128604-159128626 CCTCTGTGTAAAATCTTGTGTGG + Intronic
964797660 3:160517422-160517444 CTTGTGTATAAATTTTTGTGTGG + Intronic
965425136 3:168513716-168513738 ATTATGAGTAAATTTTTTTAAGG + Intergenic
966357621 3:179098302-179098324 TTTTTGTTTAAATTATTGTATGG + Intergenic
966380398 3:179338965-179338987 CTGCTGTGTTAATTTTTTAATGG + Intergenic
966419548 3:179723984-179724006 TTTTTTTTTAAATTTTTGTAGGG - Intronic
966711267 3:182975470-182975492 ATTCTGTGTTAATTTTTGGCTGG - Intronic
969963532 4:10971249-10971271 ATACTGTGTATATTTTTGAAGGG - Intergenic
970354917 4:15242487-15242509 CTTCTGTCTAAATTTTCCTCAGG + Intergenic
971066333 4:23036792-23036814 CTTCAGTGTAAGTTTCTGGAGGG + Intergenic
971692350 4:29853115-29853137 CATCTGTGGAAATTTATGTATGG + Intergenic
971745115 4:30569304-30569326 TTTCTGTGTAAATTATTATCCGG + Intergenic
971765391 4:30824295-30824317 CTTGTGTTTAAATTTTTGAATGG - Intronic
971909561 4:32778122-32778144 CTTCTGTGTAAAATAATGAAGGG - Intergenic
972429310 4:38965034-38965056 GTTCTTTGTAAATATTTGTTGGG - Intergenic
972529370 4:39947948-39947970 CTTATGTGCAAATTTTTGTGTGG - Intronic
973192536 4:47401879-47401901 TATCTGTGTATATTTTTCTATGG + Intronic
973571288 4:52242288-52242310 CTTCTGGTTACTTTTTTGTAAGG + Intergenic
974668131 4:64992436-64992458 CTTATCTGTAAAAATTTGTATGG + Intergenic
975364608 4:73514648-73514670 CTTCTGTGCTAATTTTTCTGAGG + Intergenic
975764295 4:77650974-77650996 CTTCTGTTTACATTTGAGTAGGG - Intergenic
977804216 4:101277344-101277366 CTGCTGTGGACATTTGTGTACGG + Intronic
978093082 4:104741634-104741656 CTTCTGGGTTTATTTTTTTATGG + Intergenic
978701024 4:111646349-111646371 CTTCTGTGTAAGTTGTGTTATGG + Intergenic
978821233 4:112968961-112968983 CTGATGTGTAATTTTTAGTAAGG - Intronic
979771601 4:124532146-124532168 CTTCATTGTAAATTCTTGTGAGG - Intergenic
980278104 4:130681959-130681981 CTTCTGGGTAAATTATTTAATGG + Intergenic
980429320 4:132670482-132670504 CTTATGGGGAAATTTTGGTATGG + Intergenic
981303280 4:143215310-143215332 CTTTTGTGTAAATGTTTTAAGGG + Intronic
981397976 4:144276666-144276688 CTCCTGTGTAACTTTATTTATGG + Intergenic
982960095 4:161825065-161825087 CTTCTATGCCAATTTTTCTAAGG + Intronic
982982843 4:162163537-162163559 CTTGTTTTTAAATTTTTGTATGG + Intronic
984400283 4:179255727-179255749 CCTCTGTGTAATTTTCTGTTTGG - Intergenic
984446796 4:179847712-179847734 CTTTTGTGTACATTTTTGTGTGG - Intergenic
985143585 4:186868819-186868841 GTTCTTTGTTAGTTTTTGTAAGG + Intergenic
986094663 5:4542660-4542682 CTTCTAGTTAAATTTTTTTATGG - Intergenic
986112081 5:4729522-4729544 CTTTTGTGTACATTTTTTCAAGG + Intergenic
988346040 5:30039232-30039254 TTTTTATGTAAATTTTTGTAGGG - Intergenic
989468225 5:41782825-41782847 CTTCTGTCTGTAGTTTTGTAGGG - Intronic
990167166 5:53007312-53007334 CTTCTCTATAAATTTTGGTTAGG - Intronic
990640834 5:57781821-57781843 CTTCAGTGTATCTTTTTGAAGGG + Intergenic
991521999 5:67510303-67510325 CATCTGTGCAGGTTTTTGTATGG - Intergenic
992023962 5:72652670-72652692 CTTCCCTGTAAAGTCTTGTATGG + Intergenic
992275121 5:75108015-75108037 CATCTATGTAAATATTTATATGG - Intronic
993545277 5:89203902-89203924 CTTCTGTGTTGATTGTTGTGGGG + Intergenic
995001663 5:107138739-107138761 CTTCTATGTAAATTTTTATGTGG + Intergenic
995258972 5:110079407-110079429 CTTCTGTGTATATATGTGAAAGG + Intergenic
995443059 5:112212950-112212972 TTTCTCTGTTAATTTTTGGATGG - Intronic
995518571 5:112977507-112977529 GTTCTCTGTAAATTCCTGTAAGG + Intronic
995687835 5:114790325-114790347 TTTGTGTGTATATGTTTGTAAGG - Intergenic
995777374 5:115738396-115738418 CTTCAGGTTATATTTTTGTAAGG + Intergenic
995908646 5:117158263-117158285 CTTCTGTATAAATTTCTTGAAGG + Intergenic
995918012 5:117274355-117274377 TTTCTCTGCAAATGTTTGTAAGG + Intergenic
996606513 5:125329409-125329431 TTACAATGTAAATTTTTGTATGG + Intergenic
997575629 5:134974769-134974791 CTTCTGTGAACATGTTGGTATGG + Intronic
997807142 5:136929451-136929473 TTTTTGTATAATTTTTTGTAAGG + Intergenic
997925257 5:138024619-138024641 CTTTTTGGTATATTTTTGTACGG - Intronic
998101757 5:139440354-139440376 ATTCTGGGTAATTTTTTGTTTGG - Intronic
998922598 5:147086046-147086068 GATCTGTGTAAATATCTGTATGG + Intergenic
999554959 5:152730038-152730060 CTTCAGTTTAGTTTTTTGTAAGG - Intergenic
1000238769 5:159389492-159389514 CTTCTGTCAAACTTTTAGTATGG + Intergenic
1000393629 5:160750261-160750283 CTTCTGTGTGAGCTTGTGTATGG - Intronic
1002661644 5:180794858-180794880 CTCCTGTGTAGGTTTTTGTAGGG - Intronic
1003288646 6:4758779-4758801 TTTCGATGTATATTTTTGTACGG + Intronic
1003522055 6:6866561-6866583 TTTATGTGTAAGTTTTTGTGTGG - Intergenic
1003757592 6:9139134-9139156 ATTCTCTGTAAATATTGGTATGG + Intergenic
1004868645 6:19879980-19880002 CTTCAGTGTCTATTTTTGTATGG - Intergenic
1005184864 6:23153960-23153982 CTTCTGTGGACACTTTTGTCAGG - Intergenic
1005184916 6:23154544-23154566 CTTCTGTGGAAACTTTTATTTGG - Intergenic
1006254652 6:32820667-32820689 CTTCTCTGTAAATGTGTCTAAGG + Intronic
1007015428 6:38461624-38461646 TTTATGTGTAAGTCTTTGTATGG + Intronic
1007310429 6:40941155-40941177 CTTCTATGTCAATTTTGCTAAGG - Intergenic
1008373636 6:50766399-50766421 ATGCTGTTTAAATTTTGGTAGGG + Intronic
1008835291 6:55820159-55820181 TTTCTGTATAAAATTTTCTATGG - Intronic
1008913553 6:56762397-56762419 CTGCTTTGTAAATTTTTGTTGGG - Intronic
1009201066 6:60746607-60746629 TTTGTGTATAAATCTTTGTATGG + Intergenic
1009525990 6:64747161-64747183 CTACTTTGTAATTTTTGGTAAGG + Intronic
1009707977 6:67279470-67279492 CTTCTGTATCAATTTTCATAAGG - Intergenic
1011531638 6:88329151-88329173 CTTTTGTGTAAGATTTTGTTTGG - Intergenic
1012048211 6:94305557-94305579 CTTGTGTATAAGTCTTTGTATGG - Intergenic
1012174432 6:96062699-96062721 CTTCTTTATACCTTTTTGTATGG + Intronic
1012210593 6:96513500-96513522 TTTCTATGTAATTTTTTGCATGG - Intergenic
1012352815 6:98274196-98274218 CATCTGTGTTAATTTTTTAAAGG + Intergenic
1012386648 6:98690463-98690485 CTTTTGTTTTAATTTTTGAATGG - Intergenic
1012969266 6:105709723-105709745 CTTTTGTGTACGTATTTGTATGG - Intergenic
1013202578 6:107914200-107914222 CTACATTGTATATTTTTGTAAGG - Intronic
1013242078 6:108255516-108255538 CTAATTTTTAAATTTTTGTAGGG + Intronic
1013731542 6:113173918-113173940 CTTTTATGTGCATTTTTGTAGGG - Intergenic
1014785588 6:125615041-125615063 CTTCTGTTTAAATGTATGTTTGG - Intergenic
1014994145 6:128120735-128120757 CTCCAGTTTAAATTTTTTTAAGG + Intronic
1015080118 6:129214017-129214039 ATTTTGTGTTAATTTTTGTGAGG + Intronic
1015127372 6:129769705-129769727 CTTCTGTTTCTATTTTTGTTCGG - Intergenic
1015181183 6:130364853-130364875 CTAATGTGGAAATTTTTGCATGG + Intronic
1017358479 6:153538039-153538061 TTTCTCTGTAAATCTCTGTAAGG + Intergenic
1019944414 7:4314958-4314980 CTTCCTGGTAAATTTTTGTGTGG - Intergenic
1020861943 7:13504268-13504290 CTAATGTTTAAAATTTTGTATGG + Intergenic
1020887843 7:13841734-13841756 CTTCTCTGTAAATATTGGCAGGG + Intergenic
1021161332 7:17276526-17276548 CTTCTTTGTAATTGTTTGTCCGG - Intergenic
1021288082 7:18806992-18807014 CTTCTTTTTTAATTTTTGAAAGG + Intronic
1022437220 7:30400126-30400148 CATTTGTGTAGATTTTTGTATGG + Intronic
1022758101 7:33316358-33316380 CTTCTGTGTAAATCTTTTTGTGG + Intronic
1023042308 7:36182480-36182502 CCTCTGTATAAGTTTTTGAAAGG - Intronic
1023149432 7:37186986-37187008 CTTCTGTATAAGTTTTTGTGTGG - Intronic
1023242769 7:38166219-38166241 TTTCTGTGTGAATTTTAGGATGG - Intergenic
1025502064 7:61314092-61314114 CTTCTGTCTAGTTTTTTGTGAGG + Intergenic
1025516931 7:61660314-61660336 CTTCTGTCTAGTTTTTTGTGAGG + Intergenic
1025541270 7:62089138-62089160 CTTCTGTCTAGTTTTTTGTGAGG + Intergenic
1025822239 7:64977239-64977261 CTCCTGTATGAATTTTTTTATGG + Exonic
1025936146 7:66039240-66039262 CTTCTGTGTTGATTGTTGTCAGG - Intergenic
1027642984 7:80760490-80760512 CATCTGTAAAAATGTTTGTATGG - Intronic
1028433922 7:90779416-90779438 CTATTTTTTAAATTTTTGTAGGG + Intronic
1028547402 7:92019036-92019058 CTTCAGTGTATATTTCAGTATGG - Intronic
1028566662 7:92240285-92240307 ATTCAGTGTACATTTTTATAGGG - Intronic
1028635869 7:92988806-92988828 TTTCTGTGTGAATTATAGTATGG + Intergenic
1029956252 7:104643475-104643497 CTACACTGTATATTTTTGTATGG + Intronic
1030154736 7:106442611-106442633 CTTGTTTGTAAGTCTTTGTATGG + Intergenic
1030280243 7:107766912-107766934 CTTCTTTGTATATTGTTATAAGG + Intronic
1030838364 7:114316957-114316979 ATTCTGGGTAAGTTTTTGTATGG - Intronic
1030907022 7:115198231-115198253 CTTCTGTGTGAATTTAAGTCTGG + Intergenic
1031133383 7:117859470-117859492 CTTCTGTGTTAACTTGTGAAAGG - Intronic
1032162437 7:129521094-129521116 CTCCTGTGTATATTTTTAAAGGG - Intergenic
1032809715 7:135400082-135400104 CTGCTGAGTAAATCTTTTTAAGG - Intronic
1032941600 7:136798936-136798958 CATTTTTGTAAAATTTTGTATGG + Intergenic
1033171417 7:139087860-139087882 CTTTTTTTTAAATTTTAGTAGGG - Intronic
1033193572 7:139306999-139307021 CTTCGGTGTGAATTTTGATAAGG + Exonic
1034116397 7:148587408-148587430 CTTCTGTGTTGATTGTTGCATGG - Intergenic
1034856239 7:154550352-154550374 TTTTTGTGTAATTTTTTGAAGGG - Intronic
1034898173 7:154890880-154890902 CTTCTTTGTATGTTTTTGGAGGG - Intronic
1035063391 7:156087010-156087032 CTTCTGTGTATGTTTATGTAAGG + Intergenic
1035627104 8:1078866-1078888 CTTGTGTGCAGGTTTTTGTATGG + Intergenic
1036084233 8:5596205-5596227 CATATATGTAAATTTTTGCAGGG + Intergenic
1037098198 8:15010856-15010878 CATCTGTGCAAATTATTGTTTGG - Intronic
1037308919 8:17534733-17534755 CTTCAGTGTAACTTTGTGCAAGG - Intronic
1037431162 8:18814830-18814852 CTTCTGTCTGAATTTCTGTCAGG + Intronic
1038108812 8:24469823-24469845 CTTCTGTTTAATTTTTTCAAGGG - Intronic
1039163816 8:34653411-34653433 CTTATGTGTAAGTTTTTGTATGG - Intergenic
1039332086 8:36548885-36548907 CTACTGTGTAAATTTCTGCAGGG - Intergenic
1039670887 8:39596635-39596657 TTTCTGTATAGATATTTGTATGG + Intronic
1039786172 8:40836032-40836054 CTGCTGTGTAGAGATTTGTAGGG - Intronic
1040809635 8:51437656-51437678 CTTCTATGCAAATTTTGGTGAGG - Intronic
1041595954 8:59653294-59653316 CTTCTGTTTAAATATTTTTGTGG - Intergenic
1041806774 8:61859782-61859804 TTTGTGTGCAAATTTTTGTGTGG + Intergenic
1042001597 8:64128609-64128631 GTTCTGTGCAAGTTTTTGTGGGG - Intergenic
1042395793 8:68290997-68291019 TTTCTGTGTAGGTTTTTATATGG + Intergenic
1043710317 8:83408329-83408351 CTTTGCTGAAAATTTTTGTAAGG - Intergenic
1044324522 8:90844568-90844590 CTTATGTCTAAACTTCTGTAGGG + Intronic
1044335056 8:90972786-90972808 CTACTATGTAAATTTGTGAAGGG + Intronic
1045607230 8:103790555-103790577 TTTGTGTGTAACTTTTTGTGTGG + Intronic
1045762437 8:105626464-105626486 TTGCTGTGTAAAATTTTGTGTGG + Intronic
1045892876 8:107178456-107178478 TTTATGTATAAGTTTTTGTAAGG - Intergenic
1046065666 8:109194222-109194244 CACCTGTGTGAATTTTTGTGTGG + Intergenic
1046131279 8:109971724-109971746 CTTCTTTGAAAATTTTGGAAAGG + Intronic
1046470719 8:114670529-114670551 CTTCTTTGGAAAGTCTTGTATGG - Intergenic
1046480383 8:114809301-114809323 TTTCTGTTGAAATTTTTGTTTGG - Intergenic
1048052653 8:130833063-130833085 CTTTTGTGTTCATTTTTGCATGG + Intronic
1048129061 8:131672999-131673021 ATTCTGTGTTAATTTTCGTTTGG - Intergenic
1048559218 8:135514995-135515017 TTGCTGTGTAAATTTATGTATGG + Intronic
1048675712 8:136777135-136777157 CTTCCGTGTCTATTTTTGGAAGG - Intergenic
1048949219 8:139480165-139480187 TTCATGTGTAAATGTTTGTATGG - Intergenic
1049169803 8:141152708-141152730 CTTGTGTGCAAGTTTTTGTGTGG + Intronic
1050531778 9:6596918-6596940 CTTCTGTGTAAATTTTTGTATGG - Intronic
1051099863 9:13508459-13508481 GTGCTGTGTAAATTTTACTAAGG - Intergenic
1052735656 9:32339676-32339698 CTTGTGTGCAGGTTTTTGTACGG - Intergenic
1053421571 9:37983226-37983248 CTCCTGTCTAAATTCTTTTAAGG - Intronic
1053614375 9:39748082-39748104 CTTCTGGGTTAATTTTTATAAGG + Intergenic
1053872403 9:42506022-42506044 CTTCTGGGTTAATTTTTATGAGG + Intergenic
1053900350 9:42789892-42789914 CTTCTGGGTTAATTTTTATAAGG - Intergenic
1054239142 9:62594310-62594332 CTTCTGGGTTAATTTTTATAAGG - Intergenic
1054261289 9:62867706-62867728 CTTCTGGGTTAATTTTTATAAGG + Intergenic
1054553274 9:66628832-66628854 CTTCTGGGTTAATTTTTATAAGG - Intergenic
1055127800 9:72738973-72738995 CTTTTTTGTAAATTTTTTTTTGG + Intronic
1055407222 9:75987611-75987633 TTTCTGTGTAAAATTCTGTTTGG - Intronic
1055532709 9:77201811-77201833 CTGCTCTGCAAGTTTTTGTATGG + Intronic
1055900772 9:81233537-81233559 CTTCTATGTGAATTGTTTTAAGG - Intergenic
1055942265 9:81661763-81661785 TTTCTGTGTACATTTTTTTTGGG - Intronic
1056192940 9:84202745-84202767 CTTGTGTGCAAGTTTTTGTGTGG - Intergenic
1056955890 9:91080803-91080825 TTTCTGTGCAAAGTTTTGTGTGG - Intergenic
1057377253 9:94536264-94536286 CTTGTGTTTAAATTCCTGTAGGG + Intergenic
1058089884 9:100793435-100793457 ATTTTGTTTAAATTTTTGTAGGG + Intergenic
1058143499 9:101383525-101383547 CTTCTGGGCAAGTTTTGGTAGGG - Intergenic
1058245667 9:102621722-102621744 CTTCTATGTTATTTTTTGTTTGG + Intergenic
1058277848 9:103067925-103067947 CCACTGTGTAAATTATTTTAAGG + Intergenic
1058953003 9:109920980-109921002 CATCTGTGTAAATTATTTTGGGG - Intronic
1058966654 9:110045175-110045197 CTTCCATGGAAATTTTTTTAGGG - Intronic
1059949751 9:119449984-119450006 TTTCTGGGTAAATTTTTTTCTGG - Intergenic
1060363452 9:122983573-122983595 CATCTGTGTTAATTTTGCTAGGG + Intronic
1187033576 X:15513730-15513752 CTTCTGTTTTAATTTTTGGAAGG - Intronic
1187070700 X:15885090-15885112 GTTTTGTTTTAATTTTTGTAGGG + Intergenic
1187438637 X:19296225-19296247 TTGATGTGCAAATTTTTGTATGG + Intergenic
1187777516 X:22778911-22778933 ATTTTGAGTTAATTTTTGTAAGG + Intergenic
1188088359 X:25930713-25930735 CTTGTGTGTAGGTTTTTGTGTGG - Intergenic
1188699924 X:33246592-33246614 CTTATGTATAAATTTTTAAATGG - Intronic
1189410832 X:40769521-40769543 CATCTGTGTACAGGTTTGTATGG + Intergenic
1189711773 X:43820256-43820278 CTTCTATGTAAATTATTGGTGGG - Intronic
1190719154 X:53132963-53132985 CTTTTGTGTGCATTTCTGTAAGG - Intergenic
1191904338 X:66073092-66073114 CTTTTATGTGAATTTTTGTAGGG - Intergenic
1193339577 X:80332382-80332404 ATTGTGTGCAAAATTTTGTATGG - Intergenic
1194410995 X:93557542-93557564 CTTCTTTGAGCATTTTTGTAGGG - Intergenic
1194629506 X:96266055-96266077 CTTTTATGTCTATTTTTGTATGG - Intergenic
1195272918 X:103250899-103250921 CTTCTGGGGAACATTTTGTAGGG - Intergenic
1195786971 X:108536051-108536073 CTGGTATGTAAATTTTTGTGAGG + Intronic
1195974541 X:110511930-110511952 GTTATGTGCACATTTTTGTAGGG + Intergenic
1196733112 X:118961218-118961240 TTTCTGTATAAGTTTTTGTGTGG - Intergenic
1196794877 X:119494175-119494197 CTTCTTTGTAAATTTCAGTCTGG - Intergenic
1197791860 X:130263234-130263256 TTTGTGTGCAAATTTTTGTGTGG - Intronic
1197794691 X:130286458-130286480 CTTCTGTATAACATTTCGTATGG - Intergenic
1198002682 X:132455363-132455385 CTTCTGTGTCGACTTTTGCAAGG + Intronic
1198068035 X:133119236-133119258 CTTCTGTTCAAATTACTGTATGG + Intergenic
1198276893 X:135103245-135103267 CTTATGTACAAATTTTTGTGTGG + Intergenic
1199261533 X:145780501-145780523 CTTCTGTGTTAATTCTGGAATGG + Intergenic
1199281454 X:146004803-146004825 CTTCTCCTTACATTTTTGTATGG - Intergenic
1199379315 X:147149551-147149573 TTTGTGTACAAATTTTTGTATGG + Intergenic
1199868430 X:151875072-151875094 TTTCTGTATTAATTTTTTTATGG + Intergenic
1200360728 X:155603754-155603776 ATTCTGTGTTATTTTGTGTATGG - Intronic
1200937569 Y:8751707-8751729 CTTCTGTCTCCATTTTTGAAAGG + Intergenic
1201187335 Y:11416931-11416953 CTGCTGTGTGAATTTTCCTAGGG + Intergenic