ID: 1050531779

View in Genome Browser
Species Human (GRCh38)
Location 9:6596931-6596953
Sequence TACACAGAAGTGTTCACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050531778_1050531779 -10 Left 1050531778 9:6596918-6596940 CCATACAAAAATTTACACAGAAG 0: 1
1: 1
2: 2
3: 47
4: 497
Right 1050531779 9:6596931-6596953 TACACAGAAGTGTTCACAGCAGG No data
1050531777_1050531779 14 Left 1050531777 9:6596894-6596916 CCAAAAGAACTGAAAACATTACA 0: 1
1: 1
2: 16
3: 101
4: 1025
Right 1050531779 9:6596931-6596953 TACACAGAAGTGTTCACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050531779 Original CRISPR TACACAGAAGTGTTCACAGC AGG Intronic
No off target data available for this crispr