ID: 1050534760

View in Genome Browser
Species Human (GRCh38)
Location 9:6622272-6622294
Sequence GGCCCGTGGAAAGAGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1100
Summary {0: 1, 1: 0, 2: 29, 3: 136, 4: 934}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050534760_1050534767 6 Left 1050534760 9:6622272-6622294 CCCTCTCCCTCTTTCCACGGGCC 0: 1
1: 0
2: 29
3: 136
4: 934
Right 1050534767 9:6622301-6622323 GGACTGTGCTGCTGCCATCTTGG 0: 73
1: 841
2: 430
3: 172
4: 1041

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050534760 Original CRISPR GGCCCGTGGAAAGAGGGAGA GGG (reversed) Intronic
900641011 1:3688045-3688067 GGCAGGCGGACAGAGGGAGAAGG + Intronic
900991171 1:6099100-6099122 AGCCCTTGGAAAGTGGGAGGTGG - Exonic
901100694 1:6716281-6716303 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
901100704 1:6716310-6716332 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
901224145 1:7601982-7602004 AGACCGTGGGGAGAGGGAGAGGG + Intronic
901228543 1:7629214-7629236 GGTCCCTGGCAAGAGAGAGAAGG + Intronic
901739205 1:11331142-11331164 GGCTCGGGGAAGCAGGGAGAGGG - Intergenic
901850046 1:12009207-12009229 AGACCGTGGGGAGAGGGAGAGGG + Intronic
901855637 1:12042687-12042709 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
902014966 1:13299421-13299443 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
902062431 1:13657380-13657402 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
902164972 1:14562842-14562864 TTCCCGTGGAAAGCAGGAGAAGG + Intergenic
902838055 1:19059327-19059349 GGGCTCTGGAAAGAGGGAGCTGG + Intergenic
903100185 1:21023264-21023286 AGACCGTGGGGAGAGGGAGAGGG - Intronic
903103231 1:21052569-21052591 AGACCGTGGGGAGAGGGAGAGGG - Intronic
903147872 1:21387062-21387084 AGACCGTGGGGAGAGGGAGACGG - Intergenic
903163146 1:21503464-21503486 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
903354032 1:22735615-22735637 GACCCCTGGGAAGTGGGAGAAGG - Intronic
903507984 1:23852464-23852486 AGACCGTGGGGAGAGGGAGAGGG - Intronic
903748281 1:25603248-25603270 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
903890468 1:26566968-26566990 GGCCTGTGGAAAGTGGCATATGG - Intronic
903993517 1:27290017-27290039 AGACCGTGGGGAGAGGGAGAGGG + Intronic
904036495 1:27561871-27561893 GGCTCATGGAAGAAGGGAGATGG + Intronic
904077168 1:27852161-27852183 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
904538104 1:31214769-31214791 GTCCTGTGGAGGGAGGGAGATGG + Intronic
904703394 1:32372596-32372618 GGACGGTGGAAGGAGGCAGATGG - Intronic
904857501 1:33510154-33510176 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
904857509 1:33510177-33510199 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
905686796 1:39914023-39914045 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
906427028 1:45723982-45724004 AGACCGTGGAGAGAGGGAGAGGG - Intronic
906741785 1:48191746-48191768 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
906770445 1:48478719-48478741 GGGCCATGGGGAGAGGGAGAGGG - Intergenic
906956651 1:50381001-50381023 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
907089811 1:51712403-51712425 AGACCGTGGGGAGAGGGAGAGGG + Intronic
907402278 1:54232587-54232609 AGACCGTGGGGAGAGGGAGAGGG - Intronic
907470471 1:54670587-54670609 GGGCTGTGGGAACAGGGAGAGGG - Intronic
908445980 1:64200465-64200487 AGACCGTGGAGAGAGGGAGAGGG - Intergenic
908467683 1:64414237-64414259 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
909127959 1:71699021-71699043 GGCCTGTGCAAGGAGGTAGAAGG - Intronic
909641311 1:77871081-77871103 AGACCGTGGGAAGGGGGAGAGGG + Intronic
910271905 1:85405083-85405105 GGCCCCTGCATAAAGGGAGAAGG - Intronic
910343608 1:86215126-86215148 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
910412876 1:86964639-86964661 AGACCGTGGGGAGAGGGAGAGGG + Intronic
910476061 1:87608755-87608777 GGCCAGTGGAGACAGGGAAATGG - Intergenic
910815875 1:91289842-91289864 AGACCGTGCAAAGAGGGAGAGGG + Intronic
910891833 1:92026868-92026890 GGACGGTGGAAAGCGGGAGGGGG + Intergenic
911326027 1:96470600-96470622 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
912316808 1:108675075-108675097 AGACCGTGGGGAGAGGGAGACGG - Intergenic
912614141 1:111080033-111080055 GGCTAGTGGAAAGGGGGAGAAGG - Intergenic
912698822 1:111861173-111861195 GGCGTGGGGAAAGAGGTAGATGG + Intronic
913022972 1:114805338-114805360 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
913200769 1:116493919-116493941 GGTCCGTGGCAACTGGGAGAAGG + Intergenic
913705522 1:121418529-121418551 AGACCGTAGAAAGAGGGAGACGG + Intergenic
914231701 1:145767986-145768008 AGACCGTGGGGAGAGGGAGAGGG + Intronic
914301124 1:146377816-146377838 GGCCTGAAGAAAGAGGAAGAGGG - Intergenic
914468496 1:147950940-147950962 AGACCGTGGGGAGAGGGAGATGG + Intronic
914787776 1:150850253-150850275 AGACCGTGGGGAGAGGGAGATGG - Intronic
914887834 1:151599589-151599611 AGACCGTGGAGAGAGGGAGAGGG - Intergenic
914894012 1:151652198-151652220 AGACCGTGGGGAGAGGGAGAGGG + Intronic
914960063 1:152197231-152197253 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
914965981 1:152257156-152257178 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
915030787 1:152878996-152879018 GGCCTGTGGGCAGAGGGAGAAGG + Intronic
915208217 1:154286908-154286930 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
916037179 1:160932680-160932702 AGACCGTGGAAAGCCGGAGAAGG - Intergenic
916046859 1:161006258-161006280 CGCCCGTGGAAAGGAGGGGAAGG - Intronic
916087657 1:161282394-161282416 AGACCGTGGGGAGAGGGAGAGGG + Intronic
916104627 1:161422268-161422290 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
916104635 1:161422291-161422313 AGACCGTGGAGAGAGGGAGAGGG - Intergenic
916320669 1:163499743-163499765 AGACCGTAGAAGGAGGGAGACGG + Intergenic
916696494 1:167242930-167242952 GGCAGGTGGAAGGAGGGGGAGGG - Intronic
916800186 1:168208618-168208640 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
917006011 1:170418240-170418262 AGACCGTGGGGAGAGGGAGACGG - Intergenic
917126820 1:171694656-171694678 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
917304438 1:173612579-173612601 AGACCGTGGGGAGAGGGAGAGGG - Intronic
917583301 1:176397558-176397580 AGACCGTGGAGAGAGGGAGAGGG + Intergenic
917583309 1:176397581-176397603 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
917598376 1:176552354-176552376 GGCGTGGGGAAAGAGGGAAAGGG - Intronic
917859729 1:179134743-179134765 AGACCGTGGAAAGAGGGAGAGGG - Intronic
918342650 1:183580312-183580334 GGTTCCTGGAAAGAGGAAGAAGG + Intronic
918983942 1:191598144-191598166 GGCCCTTGGAAAAATGGAAATGG - Intergenic
919079824 1:192856387-192856409 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
919423724 1:197405064-197405086 AGACCGTGGGGAGAGGGAGAGGG - Intronic
919538866 1:198824310-198824332 GTGCTGTGGAAAGAAGGAGAAGG - Intergenic
919959573 1:202452532-202452554 AGACCGTTTAAAGAGGGAGAGGG + Intronic
921238557 1:213153236-213153258 AGACCGTGGGGAGAGGGAGAGGG + Intronic
921828851 1:219704318-219704340 GGCCTGTGGAGAGGGAGAGAGGG - Intronic
921902954 1:220467525-220467547 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
922306681 1:224350645-224350667 AGACCGTGGAAAGTGGGAGACGG + Intergenic
922458533 1:225796819-225796841 AGACCGTCGAAAGAGAGAGAGGG + Intergenic
922632637 1:227132128-227132150 AGACCGTGGGGAGAGGGAGAGGG - Intronic
922804546 1:228378541-228378563 GGCAAGTGGAAAAGGGGAGAGGG - Intronic
923136923 1:231127863-231127885 AGACCGTGGAAAGAGGGAGAGGG - Intergenic
923174727 1:231453568-231453590 AGACCGTGGAAAGTGGGAGAGGG - Intergenic
923468413 1:234268449-234268471 AGACCGTGGAGAGAGGGAGAGGG + Intronic
923487112 1:234443948-234443970 GGCCTGGGGAAAGAGGAAAATGG + Intronic
923793197 1:237128381-237128403 AGACCGTGGGGAGAGGGAGAGGG + Intronic
924765811 1:247031553-247031575 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
924788225 1:247219934-247219956 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1062799784 10:370416-370438 GTCCCCTGGAGACAGGGAGAGGG - Intronic
1063445568 10:6112463-6112485 GGCGTGTGGCCAGAGGGAGAGGG + Intronic
1063459746 10:6207419-6207441 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1064106205 10:12502732-12502754 GGGGCGTGGAGAGAGGGTGAAGG + Intronic
1064108831 10:12520924-12520946 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1064109270 10:12523752-12523774 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1064428872 10:15254343-15254365 GGCTCGTGGGACGAGGCAGAGGG + Intronic
1065055175 10:21836899-21836921 AGACCGTGGAGAGACGGAGAGGG - Intronic
1065655283 10:27941987-27942009 GGCCCCAGGAAAGACGGGGATGG + Intronic
1067026300 10:42846715-42846737 AGAGTGTGGAAAGAGGGAGAGGG - Intergenic
1067086366 10:43242540-43242562 AGACGGTAGAAAGAGGGAGACGG - Intronic
1067117597 10:43447157-43447179 AGACGGTGGAAAGCGGGAGACGG + Intronic
1067117607 10:43447197-43447219 AGACCGTGGAAAGCGGGAGACGG + Intronic
1067285712 10:44906287-44906309 GGCTGGTGGGAAGAGGTAGAGGG + Intergenic
1067332013 10:45330916-45330938 AGACCGTGGGGAGAGGGAGACGG + Intergenic
1067339599 10:45391058-45391080 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1067339607 10:45391081-45391103 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1067354292 10:45511389-45511411 GGGCCGTGGGGAGAGGGAGAGGG - Intronic
1067391411 10:45866372-45866394 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1067871879 10:49969779-49969801 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1067911939 10:50355288-50355310 AGACAGTGCAAAGAGGGAGAGGG - Intronic
1068017266 10:51532841-51532863 GGAGAGGGGAAAGAGGGAGAAGG - Intronic
1068234686 10:54218531-54218553 TGCCCTTGGACAGAGAGAGAGGG - Intronic
1068492018 10:57736584-57736606 GGCTCCTGGAAGGAGGGAGAAGG - Intergenic
1068536106 10:58243377-58243399 AGACCGTAGAAAGAGGGAGAGGG - Intronic
1068967722 10:62929507-62929529 AGACCGTAGAAAGAGGGAGAAGG + Intergenic
1069708952 10:70477191-70477213 GGGCTGTGGCAAGAGGAAGAAGG + Intergenic
1069930220 10:71876703-71876725 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1070684324 10:78469691-78469713 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1070966295 10:80533377-80533399 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1071503130 10:86217596-86217618 GGCCCTAGGAAAGAGGCAGCCGG + Intronic
1071616292 10:87079934-87079956 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1072010391 10:91298352-91298374 AGCCCCTGGAAAGTGGGGGAGGG + Intergenic
1072180139 10:92974555-92974577 AGACCGTGGGGAGAGGGAGACGG - Intronic
1072291540 10:93970028-93970050 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1072617375 10:97058862-97058884 GGCCCTTGGTGAGTGGGAGAGGG + Intronic
1072684797 10:97529769-97529791 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1072772218 10:98151918-98151940 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1072772232 10:98151966-98151988 AGACCGTGGAAAGAGGGCGAGGG - Intronic
1072979995 10:100092204-100092226 AGACCGTGGGGAGAGGGAGACGG - Intergenic
1073036060 10:100564967-100564989 GGCCACTGGAGAGGGGGAGATGG + Intergenic
1073238063 10:102035392-102035414 AGACCGTGGGGAGAGGGAGAAGG - Intronic
1073301339 10:102472916-102472938 AGCCCGTGGAAAGGGAGATATGG - Exonic
1073450503 10:103606483-103606505 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1073955806 10:108870029-108870051 GGGGCGGGGAAAGAGGGAGGTGG + Intergenic
1075046183 10:119148273-119148295 TGCCCGTGGAGAGAGGCGGAGGG + Intronic
1075128638 10:119721371-119721393 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1075137373 10:119796060-119796082 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1075236608 10:120736559-120736581 GACCCGTGGGAAGTGGGACATGG + Intergenic
1075407464 10:122204165-122204187 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1075842619 10:125517757-125517779 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1075842629 10:125517782-125517804 AGACCGTGGAAAGAGAGGGAGGG - Intergenic
1075893077 10:125970791-125970813 GGACCGTGGAAAGTGAGAGATGG + Intronic
1075893086 10:125970831-125970853 AGACCGTGGAAAGCAGGAGACGG + Intronic
1076144868 10:128109943-128109965 GGCCCGGGGTAAGTGTGAGATGG - Intronic
1076335854 10:129706060-129706082 GGCCCCTGGCAAGAGGCAGAAGG - Intronic
1076986165 11:237171-237193 GCCCCGGCGATAGAGGGAGACGG + Intronic
1077267804 11:1660872-1660894 GGGCCGTGGAGAGTGGGACAGGG - Intergenic
1077267938 11:1661272-1661294 GGGCCGTGGAGAGTGGGACAGGG - Intergenic
1077313570 11:1904882-1904904 GGCCCGGGGAAAGGAGGAGAAGG - Intergenic
1077397371 11:2331771-2331793 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1077836905 11:5934005-5934027 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1078176704 11:8977368-8977390 AGACCGTGGGAAGGGGGAGAGGG - Intergenic
1079018143 11:16887313-16887335 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1079018151 11:16887336-16887358 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1079040074 11:17051520-17051542 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1079668169 11:23134290-23134312 GGCAGCTGGAAAGAGGGAGTTGG + Intergenic
1080097764 11:28429381-28429403 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1081574464 11:44310495-44310517 GGCCAGTGGAAGGAGAGAGGAGG - Intergenic
1081950606 11:47039450-47039472 AGACCGTGGAGAGAGGGAGAGGG + Intronic
1081950614 11:47039473-47039495 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1082126487 11:48437264-48437286 GGCCTGGGGAATGAGGGATATGG - Intergenic
1082560076 11:54608338-54608360 GGCCTGGGGAATGAGGGATATGG - Intergenic
1083130531 11:60621365-60621387 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1083208436 11:61167262-61167284 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1083728319 11:64640002-64640024 GGCCCAAGGAAAGGAGGAGAAGG - Intronic
1084048741 11:66586992-66587014 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1084388638 11:68860837-68860859 AGACCGTGGGGAGAGGGAGATGG - Intergenic
1084539164 11:69775663-69775685 GGCCGGAGCAGAGAGGGAGACGG - Intergenic
1084745878 11:71168780-71168802 AGACCGTGGAGAGAGGGAGAGGG + Intronic
1084773656 11:71360897-71360919 GGCCAGGGGAAAGAGGAAGGGGG + Intergenic
1084839089 11:71830840-71830862 AGACCGTGGAAAGAGGGAGAGGG - Intergenic
1084945148 11:72634312-72634334 GGCCTGTGGGAAGAGGAAGACGG + Intronic
1085137487 11:74105798-74105820 GGCAAGAGGAAAGAGGGAAATGG - Intronic
1085139860 11:74130080-74130102 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1085159508 11:74327819-74327841 AGACCGTGGAAAGTGGGAGACGG - Intergenic
1085382338 11:76131357-76131379 GGCCAGTGGACAGAGGATGAGGG - Intronic
1085513561 11:77099701-77099723 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1085822050 11:79804032-79804054 AGACCTTGGAAAGCGGGAGACGG - Intergenic
1086017042 11:82181191-82181213 AGACCGTGGAAAGACGGAGAGGG - Intergenic
1086122784 11:83317804-83317826 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1086341369 11:85852362-85852384 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1086435003 11:86771487-86771509 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1086446664 11:86878251-86878273 AGACCGTGGGGAGAGGGAGACGG - Intronic
1086697079 11:89860011-89860033 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1086709079 11:89984476-89984498 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1086792663 11:91062869-91062891 AGACCGTGGAAAGAGGGAGAGGG - Intergenic
1086881302 11:92156843-92156865 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1086881316 11:92156890-92156912 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1087198495 11:95322048-95322070 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1088256945 11:107911793-107911815 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1088417971 11:109610872-109610894 GGCTAGTGGACAGAGGGAAAAGG - Intergenic
1088659116 11:112027907-112027929 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1088829527 11:113523681-113523703 AGACCGTAGAAAGAGGGAGACGG - Intergenic
1089148290 11:116346391-116346413 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1089169286 11:116500871-116500893 GGCCCGTGGGGAGTGGGAGCGGG - Intergenic
1089268842 11:117287278-117287300 GGCCAGTGGACAGAGGGAGAAGG - Exonic
1089421292 11:118332727-118332749 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1089452951 11:118609923-118609945 GGCCCGAGGAGAGGGGGAGCCGG - Intronic
1089585817 11:119508854-119508876 AGACCGTGGGTAGAGGGAGAAGG + Intergenic
1089650575 11:119910244-119910266 GGCACCTGGATAGATGGAGAAGG + Intergenic
1090152952 11:124404120-124404142 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1090322731 11:125862232-125862254 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1090449270 11:126791706-126791728 AGCCCAGTGAAAGAGGGAGAGGG + Intronic
1090525757 11:127533563-127533585 GGATGGTGGAAGGAGGGAGAGGG + Intergenic
1091300258 11:134503004-134503026 GGCCCGTGGATGAAGAGAGATGG + Intergenic
1092015592 12:5155981-5156003 GACCAGGGGAAATAGGGAGAAGG - Intergenic
1092331656 12:7591151-7591173 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1092331670 12:7591207-7591229 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1092401613 12:8183421-8183443 AGACCGTGGAGAGAGGGAGAGGG - Intronic
1092590790 12:9952199-9952221 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1092828034 12:12415545-12415567 AGACCGTGGAGAGAGGGGGAGGG + Intronic
1092850170 12:12619021-12619043 AGACCGTGGAAAGTGGGAGACGG + Intronic
1093038347 12:14354061-14354083 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1093050923 12:14503950-14503972 GCCACCTGGAAAGAGGGAGGAGG + Exonic
1093927671 12:24925578-24925600 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1094209247 12:27873345-27873367 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1095114065 12:38331284-38331306 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1095668393 12:44830593-44830615 GGCCTGTGGAAACAAGGACAGGG - Intronic
1095853283 12:46832607-46832629 GGACCCAGGAAAGAGGGAGCAGG - Intergenic
1095949491 12:47773952-47773974 GCCCTCTGGAAGGAGGGAGATGG - Intronic
1095977877 12:47952126-47952148 GGCCTGTGGGAAAAGGGACAAGG + Intergenic
1096063788 12:48724031-48724053 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1096063796 12:48724054-48724076 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1096167747 12:49437836-49437858 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1096224797 12:49860221-49860243 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1096391022 12:51229151-51229173 GGCCCGGTGCAACAGGGAGAAGG + Intergenic
1096856839 12:54489250-54489272 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1096856849 12:54489279-54489301 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1096968822 12:55649140-55649162 AGACCGTGCAGAGAGGGAGAGGG + Intergenic
1097028713 12:56076727-56076749 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1097138361 12:56878755-56878777 AGACCGTGGAAAGCAGGAGACGG - Intergenic
1097148936 12:56962835-56962857 AGACCGTGGGGAGAGGGAGACGG - Intergenic
1097194031 12:57233985-57234007 GGCCCCTGGAACGAGGCACAAGG - Exonic
1097990264 12:65825601-65825623 GGCCCGGGGAAGGCGGGAGGTGG + Intronic
1098371088 12:69760387-69760409 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1098774045 12:74588915-74588937 AGACCGTGCAAAGAGGGAGAGGG + Intergenic
1098883565 12:75941031-75941053 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1099018255 12:77371446-77371468 TACCAGTGGGAAGAGGGAGAGGG + Intergenic
1099255712 12:80308974-80308996 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1099935429 12:89119346-89119368 GGACGGGGGAAGGAGGGAGAGGG - Intergenic
1100454502 12:94739366-94739388 GGCGGGTGGGAAGAGAGAGAGGG - Intergenic
1100577781 12:95908433-95908455 AGACCGTGGAAAGAGGGAGAGGG + Intronic
1100581842 12:95946639-95946661 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1101885018 12:108655374-108655396 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1102175175 12:110868703-110868725 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1102186529 12:110951838-110951860 AGACCCTGGAAAGAGGGAGAGGG + Intergenic
1102294379 12:111724776-111724798 AGACCGTGGAAAGAGAGGGAGGG + Intronic
1102294412 12:111724900-111724922 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1102509441 12:113404089-113404111 GGGAAGTGGAAAGAGGGAGGAGG - Intronic
1103097594 12:118144566-118144588 GGCCTGTGGGGAGAGGCAGAGGG - Exonic
1103300062 12:119919707-119919729 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1103591087 12:121992991-121993013 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1103641527 12:122356626-122356648 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1103872832 12:124102975-124102997 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1104727690 12:131087981-131088003 AGCCCGTGGGAGGAGAGAGAAGG - Intronic
1105367521 13:19778395-19778417 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1105527258 13:21187410-21187432 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1105555776 13:21447306-21447328 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1105558356 13:21466688-21466710 GGCTGGTGGAAAGAGGGTGTGGG - Intergenic
1105976998 13:25481163-25481185 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1106746633 13:32715647-32715669 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1106747861 13:32722333-32722355 AGACCGTGGAAAGCGGGAGATGG + Intronic
1106782633 13:33074725-33074747 GGCCCGTGGAGACAGGGGAATGG + Intergenic
1107042688 13:35966518-35966540 AGACCGTGCAAAGAGGGAGAGGG - Intronic
1107165616 13:37279538-37279560 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1107165637 13:37279601-37279623 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1107589088 13:41882811-41882833 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1107605143 13:42048992-42049014 GCCGCGTGGAAAGCGGGAGGTGG + Intronic
1108370154 13:49761206-49761228 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1108370169 13:49761252-49761274 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1108501788 13:51077138-51077160 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1108504319 13:51097528-51097550 GCCCCATGGAAAGTGTGAGAAGG - Intergenic
1108608362 13:52063027-52063049 GGACCGTGGGGAGAGGGAGAGGG - Intronic
1109142200 13:58727621-58727643 CGCACGTGGAATGAGGGAGCAGG + Intergenic
1109265878 13:60199704-60199726 GGCCCAAGGAGAGAGGGAGATGG + Intergenic
1109326731 13:60876922-60876944 TGCTCCTGGGAAGAGGGAGAGGG + Intergenic
1110965113 13:81685044-81685066 GGATAGTGGAAAGAGGGAGGTGG - Intergenic
1110988253 13:82002711-82002733 GGTTCATGGAAGGAGGGAGAGGG - Intergenic
1110998756 13:82149978-82150000 GGACTGGGGAAAGAGGGAAATGG - Intergenic
1111560052 13:89932808-89932830 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1111736061 13:92140747-92140769 GGCCCCTGTAATGAGGGAGCTGG + Intronic
1111976222 13:94968802-94968824 TTCCCGGGGAAAAAGGGAGAGGG + Intergenic
1112033578 13:95477839-95477861 GGCCCGTGGACAGATGGAGGAGG + Intronic
1112208820 13:97352441-97352463 GGCCTGAGGAAGGAGAGAGAGGG + Intronic
1112886072 13:104173568-104173590 GGCCAGTGGATGCAGGGAGATGG + Intergenic
1113101293 13:106722155-106722177 GGCTGGTGGAAAGGGGGAGCAGG + Intergenic
1113242641 13:108355477-108355499 GCCCCGTGGGAACAGGCAGAGGG + Intergenic
1114137092 14:19865724-19865746 AGACCGTGCAAAGAGGGCGAGGG - Intergenic
1114164993 14:20212037-20212059 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1114594473 14:23899181-23899203 AGACCGTGGAAAGCGGGAGACGG + Intergenic
1115329763 14:32183900-32183922 GGGCCTTGAAAAGAGAGAGATGG + Intergenic
1115382855 14:32759340-32759362 GGCACGAGGAAAAAGGCAGAGGG - Intronic
1115847838 14:37556519-37556541 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1116408958 14:44600804-44600826 AGACCGTGGAGAGAGGGAGAGGG - Intergenic
1117276829 14:54202607-54202629 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1118209515 14:63752065-63752087 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1118239170 14:64038850-64038872 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1118517905 14:66546779-66546801 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1118584536 14:67340687-67340709 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1118890186 14:69902605-69902627 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1119051992 14:71377953-71377975 AGACCGTGGAAAGCAGGAGATGG + Intronic
1119052003 14:71377993-71378015 AGACAGTGGAAAGAAGGAGAGGG + Intronic
1119183238 14:72618462-72618484 GGCCTATGGACAGAGGAAGACGG - Intergenic
1119544227 14:75460180-75460202 GACCCCTGGAATGGGGGAGAAGG - Intronic
1119595178 14:75926078-75926100 GGGCCGTGGGGAGAGGGAGAGGG + Intronic
1119875799 14:78058129-78058151 GTTCCTTGGAAAGAAGGAGAGGG - Intergenic
1119898675 14:78242371-78242393 GACCTGTGGGAAGAGGGGGAGGG - Intronic
1120086922 14:80285986-80286008 AGACCGTGGGGAGAGGGAGATGG - Intronic
1120310045 14:82815294-82815316 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1120547767 14:85830667-85830689 AGACCGTGGGAAGATGGAGAGGG + Intergenic
1121047528 14:90799086-90799108 GGCCCAGGGAGAGTGGGAGATGG - Intronic
1121143092 14:91558388-91558410 GGACCGTGGGGAGAGGGAGAGGG + Intergenic
1121357986 14:93231204-93231226 AGTCCGTGGAAAGAGCGAGAAGG + Intergenic
1121660982 14:95634916-95634938 GGAGCCTGGAAAGACGGAGAAGG - Intergenic
1121801432 14:96777532-96777554 GGCCAATGGAATGTGGGAGAAGG - Intergenic
1122931055 14:104933270-104933292 GGCCCTTGGCAAGAGGATGAAGG - Exonic
1122957929 14:105080047-105080069 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1122986633 14:105214618-105214640 GGCAGGTGGCCAGAGGGAGATGG + Intronic
1202847950 14_GL000009v2_random:199393-199415 GGAACGTGGGGAGAGGGAGAGGG - Intergenic
1202917433 14_GL000194v1_random:189945-189967 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1124335251 15:28850648-28850670 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1124335261 15:28850677-28850699 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1124335269 15:28850700-28850722 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1124712827 15:32029993-32030015 GGCTCGCGGAAAGCGGGAGGAGG + Intergenic
1124961108 15:34395857-34395879 GGGCCTTGGAGGGAGGGAGAGGG + Intronic
1124977738 15:34542078-34542100 GGGCCTTGGAGGGAGGGAGAGGG + Intronic
1125459840 15:39895227-39895249 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1125731275 15:41893962-41893984 GGGCTGTGGAGGGAGGGAGAGGG + Exonic
1125868318 15:43075975-43075997 AGACCGTGGAGAGAGGGAGAGGG - Intronic
1125947686 15:43723320-43723342 GGGCAGGGGAGAGAGGGAGAGGG + Intergenic
1126188705 15:45856440-45856462 GGCCTGTGAAGAGAGAGAGAAGG + Intergenic
1126571458 15:50157743-50157765 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1126691660 15:51293545-51293567 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1126752102 15:51886705-51886727 AGACCGTGGAGAGAGGGAGAGGG + Intronic
1127023979 15:54782072-54782094 AGACCGTGGAAAGCGGGAGACGG + Intergenic
1127023990 15:54782112-54782134 AGACCGTGGAAAGCGGGAGACGG + Intergenic
1127153928 15:56109059-56109081 AGACCGTGGAAAGAGGGAGAGGG - Intronic
1127718119 15:61671168-61671190 GGCCAGTAATAAGAGGGAGATGG + Intergenic
1127783151 15:62333317-62333339 GGGCCGTGGGGAGAGGGAGAGGG + Intergenic
1127874136 15:63098263-63098285 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1128597649 15:68965523-68965545 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1128843879 15:70872377-70872399 AGACCGCGGAAAGTGGGAGACGG + Intronic
1129054323 15:72808076-72808098 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1129192851 15:73947508-73947530 GGCTGATGGAAAGAGGGATATGG - Intronic
1129589051 15:76899172-76899194 AGACCATAGAAAGAGGGAGACGG - Intronic
1129902984 15:79166007-79166029 GGCCCAAGTAAAGAGGAAGAAGG + Intergenic
1130321787 15:82848218-82848240 AACCCGAGGAAGGAGGGAGATGG - Intronic
1130341012 15:82999142-82999164 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1130428538 15:83823178-83823200 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1131001590 15:88942682-88942704 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1131126996 15:89867036-89867058 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1131479548 15:92769327-92769349 AGACCGTGGGGAGAGGGAGACGG + Intronic
1131479561 15:92769369-92769391 AGACCGTGGGGAGAGGGAGACGG + Intronic
1131479568 15:92769392-92769414 AGACCGTGGGGAGAGGGAGACGG + Intronic
1131479575 15:92769415-92769437 AGACCGTGGGGAGAGGGAGACGG + Intronic
1132381062 15:101367033-101367055 GGCCCGTGGAGAGCGGGGGGAGG + Intronic
1132846367 16:2002776-2002798 GGCCTGTGGGAAGAGGCAGGAGG - Intronic
1132992423 16:2802853-2802875 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1133064673 16:3197667-3197689 GGGCTGGGGAGAGAGGGAGAGGG + Intergenic
1133485500 16:6214992-6215014 GGGACAGGGAAAGAGGGAGAAGG + Intronic
1133773630 16:8882191-8882213 GGGCCGTGGAAACATGGAGCAGG + Intergenic
1134082937 16:11336685-11336707 AGACCGTGGAAAGAGGGAAGAGG + Intronic
1134398670 16:13889091-13889113 AGACCGTGGAAAGCCGGAGAAGG - Intergenic
1134750305 16:16619823-16619845 AGACCGTGGAAAGTGGGAGACGG + Intergenic
1134995153 16:18733775-18733797 AGACCATGGAAAGTGGGAGACGG - Intergenic
1135414448 16:22258027-22258049 GGCACGTGGAGATAGTGAGAAGG + Intronic
1135575429 16:23582706-23582728 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1135575439 16:23582735-23582757 AGACCGTGGGAAGAGGGAGAGGG - Intronic
1135575458 16:23582793-23582815 AGACCGTGGGAAGAGGGAGAGGG - Intronic
1135589576 16:23695385-23695407 GTCCCCTGGAAAGTGGGTGATGG + Exonic
1135639873 16:24110103-24110125 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1136160382 16:28415870-28415892 AGACCGTGGGGAGAGGGAGACGG - Intergenic
1136202713 16:28699444-28699466 AGACCGTGGGGAGAGGGAGACGG + Intronic
1136504442 16:30693926-30693948 GTCCTGTGGGGAGAGGGAGAAGG + Intergenic
1136568201 16:31082227-31082249 GGCGCAGGGAAAGAGGGACAGGG - Intronic
1136572675 16:31106029-31106051 AGCCCGTGGTAAAAGGGAGCGGG - Intergenic
1137240966 16:46654131-46654153 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1137523193 16:49211210-49211232 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1137676606 16:50306690-50306712 GGACCTTGGAAAGAGAGAGACGG + Intronic
1137718096 16:50611194-50611216 GGGACCTGGAGAGAGGGAGATGG - Intronic
1138043207 16:53697327-53697349 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1138339167 16:56277335-56277357 GGCCTGTGGAAAGAGGGAATGGG + Intronic
1138400745 16:56740997-56741019 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1138642760 16:58397814-58397836 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1139623392 16:68164398-68164420 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1139864018 16:70050327-70050349 AGACCGTGGAGAGAGGGAGGGGG - Intergenic
1140992869 16:80231335-80231357 GGCCAGTGGGTAGAGTGAGAAGG + Intergenic
1140993918 16:80242566-80242588 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1141446071 16:84059262-84059284 GCCCCGTGGAAAGAGTGGAAGGG + Intronic
1141644738 16:85361450-85361472 GTGGCCTGGAAAGAGGGAGACGG - Intergenic
1141750436 16:85954685-85954707 GGCTCTTGAAAAGAGAGAGAAGG - Intergenic
1141999652 16:87656900-87656922 GCCCCGTGAACAGAGCGAGAAGG - Intronic
1142533435 17:597960-597982 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1142634429 17:1247902-1247924 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1142705437 17:1690641-1690663 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1142825157 17:2506262-2506284 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1142940059 17:3372806-3372828 AGACCATGGAAAGAGGGAGAGGG + Intergenic
1142949036 17:3463969-3463991 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1143008650 17:3853605-3853627 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1143410677 17:6706610-6706632 GCCACGTGGCAAGAGAGAGAAGG + Intronic
1143493068 17:7294858-7294880 GGCCGGTGGAAAGGGGCGGAGGG - Intergenic
1144541159 17:16144812-16144834 AGACCGTGGAAAGCGGGAGAAGG - Intronic
1144541175 17:16144884-16144906 AGACCGTGGAAAGCGGGAGAAGG - Intronic
1144541186 17:16144928-16144950 AGACGGTGGAAAGCGGGAGAAGG - Intronic
1144860248 17:18297440-18297462 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1144860256 17:18297463-18297485 AGACCGTGGAGAGAGGGAGACGG - Intronic
1145026908 17:19475329-19475351 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1145047461 17:19628865-19628887 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1145053779 17:19684853-19684875 AGACCGTAGAAAGAGGGAGATGG - Intronic
1145158251 17:20556968-20556990 AGACCATGGAAAGTGGGAGACGG - Intergenic
1145775713 17:27526945-27526967 GGCCCATGAAAGGAGAGAGAAGG - Intronic
1145985996 17:29046676-29046698 GGCAGCAGGAAAGAGGGAGAGGG + Intronic
1146155724 17:30522812-30522834 AGACCGTGGGGAGAGGGAGAGGG - Exonic
1146731463 17:35196010-35196032 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1147150786 17:38512459-38512481 GGCCCAGGGAAGGAGGGCGATGG + Intergenic
1147155642 17:38543366-38543388 GAGCCCTGGGAAGAGGGAGAGGG + Intronic
1147277732 17:39333159-39333181 AGACCGTGCAAAGAGGGAGACGG - Intronic
1147278251 17:39336974-39336996 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1147622160 17:41875409-41875431 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1147622168 17:41875432-41875454 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1147622176 17:41875455-41875477 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1147708869 17:42448452-42448474 AGACCGTGGGTAGAGGGAGAGGG - Intergenic
1148016143 17:44523988-44524010 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1148050792 17:44769174-44769196 GGCCCCTGGAAACTGGGCGACGG - Intronic
1148269758 17:46253745-46253767 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1148331746 17:46817722-46817744 GGACCGAGGAGAAAGGGAGAGGG - Intronic
1148408891 17:47447310-47447332 GGACTGAGGAAAGAGGGAGGAGG - Intergenic
1149780815 17:59395071-59395093 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1150119961 17:62592676-62592698 GGACCGGGGACAGGGGGAGATGG + Intronic
1150213743 17:63455830-63455852 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1150213751 17:63455853-63455875 AGACCGTGGAGAGAGGGAGAGGG - Intergenic
1150477071 17:65483786-65483808 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1150477085 17:65483835-65483857 AGACCGTGAAGAGAGGGAGAGGG - Intergenic
1150894792 17:69196996-69197018 AGACCGTGGACAGAGGGAGGGGG + Intronic
1151313439 17:73308356-73308378 GGCCTGTGGGCGGAGGGAGAAGG - Intronic
1151745565 17:76010000-76010022 GGCCCTTGAGAAGAGGGAGGTGG - Exonic
1152128973 17:78464954-78464976 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1152590577 17:81209516-81209538 GGTCCGTGGAAAGGGGTGGAGGG + Intronic
1155328225 18:24687692-24687714 GGAGGGTGGGAAGAGGGAGAGGG - Intergenic
1156066505 18:33148437-33148459 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1156239719 18:35241122-35241144 GGCCCCTAGGAAGAGGGAGGTGG + Intronic
1156326518 18:36078658-36078680 AGACCGTGGGGAGAGGGAGACGG + Intergenic
1156326526 18:36078681-36078703 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1156507574 18:37608047-37608069 GTACCAAGGAAAGAGGGAGACGG + Intergenic
1157403597 18:47405757-47405779 GGCCTGGGGAGATAGGGAGAAGG + Intergenic
1157455734 18:47827477-47827499 AGACCGTAGAAAGTGGGAGACGG - Exonic
1157487860 18:48101147-48101169 GGCCAGAGGAAGGAGGAAGATGG - Intronic
1157677616 18:49578994-49579016 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1157709853 18:49842833-49842855 GCCCCTTGGAAAGGTGGAGAGGG + Intronic
1158148383 18:54342485-54342507 AGACCGTGGGGAGAGGGAGACGG - Intronic
1158410776 18:57203963-57203985 GGGCAGTGGAAAGAGAGATAAGG + Intergenic
1158430650 18:57383439-57383461 GGGCTGGGGAAAGAGGGAAATGG - Intergenic
1160009059 18:75089930-75089952 CGCCTGTGGCAGGAGGGAGAGGG - Intergenic
1160228573 18:77029418-77029440 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1160465637 18:79073605-79073627 AGACCGTGGAAAGCGGGAGACGG + Intronic
1160465649 18:79073644-79073666 AGACCGTGGAAAGCGGGAGACGG + Intronic
1160700652 19:505445-505467 GGACTGTGGGATGAGGGAGATGG - Intergenic
1160736406 19:664479-664501 TGCCTGGGGAAAGAGAGAGAGGG + Intergenic
1160868957 19:1268388-1268410 GGCCTGTGGAAGGAGAGAAAAGG + Intronic
1161203568 19:3028999-3029021 TGCCCGAAGAAAGAGGGAGGAGG + Exonic
1161270512 19:3387070-3387092 GGCCCTGGGATAGAGGGAGAGGG + Intronic
1161685604 19:5701345-5701367 AGACCATGGAAAGAGGGAAAGGG - Intronic
1162036549 19:7943282-7943304 GTCCCGTGGAAAAAAGTAGAGGG - Intronic
1162055666 19:8062395-8062417 GGCAACTGGAAAGAGGGAGTTGG + Exonic
1162065632 19:8123740-8123762 GGCCCCTGGAAGGATGGGGAGGG - Intronic
1162278800 19:9679329-9679351 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1162538359 19:11277501-11277523 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1162694907 19:12467126-12467148 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1163142878 19:15362371-15362393 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1163167358 19:15507616-15507638 GGCCCTTGGAAAGAGGGCGTGGG - Intergenic
1163542070 19:17917637-17917659 AGACCGTGGAGAGAGGGAGAGGG - Intergenic
1163676613 19:18658523-18658545 GACCCAGGGAGAGAGGGAGAGGG - Intronic
1163986266 19:20953433-20953455 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1164043354 19:21512059-21512081 AGACCATGGAAAGAGGGAGAGGG + Intronic
1164043362 19:21512082-21512104 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1164106280 19:22108691-22108713 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1164231358 19:23290790-23290812 AGACCATGGAAAGTGGGAGACGG + Intergenic
1164256803 19:23534339-23534361 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1164263762 19:23594147-23594169 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1164528528 19:29029485-29029507 GAAACGTGGAAAGTGGGAGATGG + Intergenic
1165190104 19:34056149-34056171 GGCATGGGGAAAGAGGAAGAAGG - Intergenic
1165199215 19:34131902-34131924 AGACCGTGGAAAGAGGGAGAGGG - Intergenic
1165482070 19:36070005-36070027 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1165511626 19:36269668-36269690 GGGCCACGGAAAGAGCGAGAAGG - Intergenic
1165512175 19:36272169-36272191 GGGCCACGGAAAGAGCGAGAAGG - Intergenic
1165512722 19:36274710-36274732 GGGCCACGGAAAGAGCGAGAAGG - Intergenic
1165513279 19:36277265-36277287 GGGCCACGGAAAGAGCGAGAAGG - Intergenic
1165513827 19:36279799-36279821 GGGCCACGGAAAGAGCGAGAAGG - Intergenic
1165514381 19:36282336-36282358 GGGCCACGGAAAGAGCGAGAAGG - Intergenic
1165514931 19:36284869-36284891 GGGCCACGGAAAGAGCGAGAAGG - Intergenic
1165515482 19:36287405-36287427 GGGCCACGGAAAGAGCGAGAAGG - Intergenic
1165516033 19:36289942-36289964 GGGCCACGGAAAGAGCGAGAAGG - Intergenic
1165516583 19:36292470-36292492 GGGCCACGGAAAGAGCGAGAAGG - Intergenic
1165517136 19:36294991-36295013 GGGCCACGGAAAGAGCGAGAAGG - Intergenic
1165517688 19:36297526-36297548 GGGCCACGGAAAGAGCGAGAAGG - Intergenic
1165518241 19:36300061-36300083 GGGCCACGGAAAGAGCGAGAAGG - Intergenic
1165518791 19:36302593-36302615 GGGCCACGGAAAGAGCGAGAAGG - Intergenic
1165519340 19:36305108-36305130 GGGCCACGGAAAGAGCGAGAAGG - Intergenic
1165519888 19:36307636-36307658 GGGCCACGGAAAGAGCGAGAAGG - Intergenic
1165618666 19:37225503-37225525 GGGCTGGGGAAAGAGGGAAATGG - Intronic
1165727890 19:38125009-38125031 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1166640006 19:44488072-44488094 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1166668207 19:44694251-44694273 GGGCAGGGGAAAGTGGGAGAAGG - Intergenic
1166811546 19:45517520-45517542 GCCACGTGGACAGAAGGAGACGG - Intronic
1166873866 19:45885795-45885817 GGCCGGTGGAACGCGGGAGCTGG - Exonic
1167038627 19:47009118-47009140 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1167547925 19:50140369-50140391 AGACCGTGGGGAGAGGGAGACGG - Intergenic
1167618896 19:50550685-50550707 GGGCAGGGGAAAGAGGGAGCTGG + Intronic
1167975338 19:53222258-53222280 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1168517365 19:57018737-57018759 GGACCCTGGAACGAGGGAGGTGG - Intergenic
1168582933 19:57570351-57570373 GACCTGTGGGTAGAGGGAGAAGG + Intergenic
1168658124 19:58146539-58146561 AGACCGTGGGGAGAGGGAGAGGG - Intronic
924970792 2:126205-126227 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
925305752 2:2847032-2847054 TGTGTGTGGAAAGAGGGAGAAGG - Intergenic
925400666 2:3570000-3570022 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
925407755 2:3616767-3616789 AGACCGTGGGGAGAGGGAGAGGG + Intronic
925407763 2:3616790-3616812 AGACCGTGGGGAGAGGGAGAGGG + Intronic
925587197 2:5475559-5475581 GGGGCCTGGGAAGAGGGAGAGGG + Intergenic
926215717 2:10903864-10903886 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
926322829 2:11760663-11760685 AGACCGTGGAAAGAGGGACAGGG + Intronic
926618064 2:15019450-15019472 AGCAGGTGGAAAGAGGAAGAGGG + Intergenic
926675230 2:15613014-15613036 AGACCGTGGGGAGAGGGAGAGGG + Intronic
926777964 2:16440700-16440722 GGCCCCGGGAAAGAGGGGAAGGG + Intergenic
928143619 2:28751984-28752006 GGCCCGGGAAAAGGGGGAGTTGG + Exonic
928190218 2:29158502-29158524 GGACCTTTCAAAGAGGGAGATGG + Intronic
928888644 2:36179311-36179333 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
929246792 2:39711012-39711034 GGCCCTAGGGAAGAGGAAGAGGG - Intronic
929415823 2:41746102-41746124 AGACCGTGGGGAGAGGGAGACGG - Intergenic
929577935 2:43063990-43064012 AGACCGTGGAAAGAGGGAGAGGG + Intergenic
929654412 2:43716204-43716226 GGCCCCTGGAAGAAGGGAGGAGG + Intronic
929683266 2:44012340-44012362 TGCCTGTGGCAAGTGGGAGAAGG - Intergenic
929690478 2:44068341-44068363 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
930096169 2:47568954-47568976 GGCCCAGGGAAAGTGGGGGATGG + Intronic
930174173 2:48284725-48284747 GGCACATAGAAAGAGGGAGGAGG - Intergenic
930396561 2:50829253-50829275 AGACCGTGGGGAGAGGGAGAGGG + Intronic
930665755 2:54096840-54096862 AGACCGTGGGGAGAGGGAGAGGG + Intronic
930834132 2:55774732-55774754 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
931263498 2:60640133-60640155 GGAGCCTGGAAGGAGGGAGAGGG - Intergenic
931479737 2:62629592-62629614 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
931479745 2:62629615-62629637 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
931479753 2:62629638-62629660 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
931479761 2:62629661-62629683 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
931479769 2:62629684-62629706 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
931576230 2:63721728-63721750 AGACCGTGGGGAGAGGGAGAGGG - Intronic
931656483 2:64513191-64513213 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
931783888 2:65601824-65601846 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
931926833 2:67082545-67082567 GGACGGTGGGAAGAGGAAGAGGG + Intergenic
932410439 2:71543869-71543891 AGACCGTGGGGAGAGGGAGAGGG + Intronic
932603350 2:73145536-73145558 AGCCTGTGAAAGGAGGGAGAAGG - Intronic
932757267 2:74417455-74417477 GGCCACTGCAAAGAGGGAGTAGG + Exonic
932903309 2:75724582-75724604 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
933273432 2:80258593-80258615 TGCCTCTGGAAACAGGGAGATGG - Intronic
933734788 2:85487035-85487057 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
934548905 2:95242821-95242843 AGACCGTGGGGAGAGGGAGAGGG - Intronic
934780832 2:96968658-96968680 GGCCCCTGGGAGGAGGGTGATGG - Intronic
935498236 2:103807456-103807478 GGGCTTCGGAAAGAGGGAGAAGG + Intergenic
935636034 2:105250625-105250647 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
936039588 2:109140108-109140130 GGACGGTGGACAGAGGGAAAAGG - Intronic
936043531 2:109168445-109168467 GGCTCTTGGCAGGAGGGAGAGGG + Intronic
936158367 2:110064624-110064646 AGACCGTGCAAAGAGGGAGACGG + Intergenic
936186294 2:110306702-110306724 AGACCGTGCAAAGAGGGAGACGG - Intergenic
936460350 2:112709797-112709819 GGTGTGTGGACAGAGGGAGAGGG + Intergenic
937168930 2:119845224-119845246 AGACCGTGGGGAGAGGGAGAGGG + Intronic
937437425 2:121892071-121892093 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
938533624 2:132220364-132220386 AGACCGTGGGGAGAGGGAGAGGG - Intronic
938829285 2:135034781-135034803 AGACCGTGGAAAGAGAGGGAGGG + Intronic
940817448 2:158311448-158311470 AGACTGTGGAAAGCGGGAGATGG + Intronic
940817458 2:158311488-158311510 AGACCGTGGAAAGCGGGAGACGG + Intronic
941024948 2:160448308-160448330 AGACCGTGCAAAGAGGGAGACGG - Intronic
941197412 2:162469695-162469717 AGACCGTGGGGAGAGGGAGAGGG - Intronic
941793509 2:169576149-169576171 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
941814985 2:169787343-169787365 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
941847598 2:170149051-170149073 AGACCGTGGAAAGAGGGAGAGGG - Intergenic
942021196 2:171867629-171867651 AGACCGTGGGGAGAGGGAGAGGG + Intronic
942355472 2:175107531-175107553 AGACCGTGGGGAGAGGGAGAGGG - Intronic
942426206 2:175863404-175863426 GGCCCCTGGGATGAGGGAGAGGG - Intergenic
942621199 2:177846002-177846024 AGACCGTGGAAAGAGAGGGAGGG + Intronic
942621209 2:177846027-177846049 AGACCGTGGGGAGAGGGAGAGGG + Intronic
942629959 2:177944844-177944866 AGACCGTGGGGAGAGGGAGAGGG - Intronic
942894863 2:181040259-181040281 GTCCCGTGGAAGGACGAAGAAGG - Intronic
943323278 2:186472262-186472284 AGACCGTGGAAAGAGGGAGAGGG - Intergenic
943577884 2:189652934-189652956 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
943740193 2:191399261-191399283 AGACCGTGGGGAGAGGGAGAGGG + Intronic
943863054 2:192893494-192893516 AGACCGTGCAAAGAGGGAGACGG - Intergenic
944128524 2:196320487-196320509 GGCCTGTGGAAAGACGGCGAAGG - Intronic
944255154 2:197618074-197618096 AGACCGTGGGGAGAGGGAGAGGG - Intronic
944283731 2:197924129-197924151 AGACCGTGGGGAGAGGGAGAGGG + Intronic
944440883 2:199742273-199742295 GGCCAGGGGAAAGAAGGAGCAGG - Intergenic
944733239 2:202536081-202536103 AGACCGTGGGGAGAGGGAGAGGG + Intronic
944815757 2:203373477-203373499 GGGCCGTGGGGAGAGGGAGAGGG + Intronic
945192876 2:207208308-207208330 GGTACCTGGAAAGAGGGAAAGGG + Intergenic
946000055 2:216474822-216474844 GGACCGTGGAAAGAGGAGGGAGG + Intronic
946091926 2:217234465-217234487 GGAGGGTGGAAAGAGGGAGAGGG - Intergenic
946317963 2:218930787-218930809 AGACCGTGGGGAGAGGGAGAAGG - Intergenic
946350301 2:219146623-219146645 GGCACCTGGAAAGAGGAAGTAGG + Intronic
946650788 2:221891510-221891532 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
947747569 2:232516864-232516886 TGCCTGTGGAAGGATGGAGATGG + Intergenic
947828911 2:233125260-233125282 GGACCAGGGAGAGAGGGAGAGGG + Intronic
947949686 2:234136302-234136324 GGCCAGTGGTAAGAGTGACATGG - Intergenic
948249527 2:236514601-236514623 GGCTGGTGGAAGGAGGGAGTGGG + Intergenic
948590856 2:239048982-239049004 GGCCCGTGGAAGGAGATAAAAGG + Exonic
948651828 2:239450385-239450407 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1169109031 20:3020081-3020103 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1169441946 20:5640031-5640053 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1169802768 20:9528118-9528140 GGCCATTGAAAAGAGTGAGATGG + Intronic
1170592042 20:17778565-17778587 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1170645537 20:18193894-18193916 AGACCGTGGGTAGAGGGAGAGGG - Intergenic
1170811821 20:19679580-19679602 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1171200264 20:23235016-23235038 AGCCAGTGGAATGAGGTAGAAGG - Intergenic
1171366325 20:24627117-24627139 GGACCGTGGGGAGAGGGAGAGGG + Intronic
1171848653 20:30292659-30292681 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1171861068 20:30404206-30404228 AGACCGTGGCGAGAGGGAGAGGG - Intergenic
1172058880 20:32175356-32175378 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1172141002 20:32723158-32723180 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1172209391 20:33186202-33186224 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1172258283 20:33537501-33537523 GGGCCGTGGTGAGAGTGAGAGGG + Intronic
1172279766 20:33700742-33700764 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1172337730 20:34131833-34131855 AGACCGTGGGGAGAGGGAGATGG - Intergenic
1172348378 20:34222652-34222674 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1172379419 20:34475662-34475684 AGACCGTGGGGAGAGGGAGACGG + Intronic
1172401774 20:34657956-34657978 AGACCGTGGAGAGAGAGAGAGGG - Intronic
1172575214 20:36002379-36002401 AAACCGTGGAAAGAGGGAGAGGG + Intronic
1172575223 20:36002408-36002430 AGACCGTGGGGAGAGGGAGACGG + Intronic
1172720799 20:36999480-36999502 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1172728711 20:37068837-37068859 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1172735656 20:37125233-37125255 AGACCGTGGAAAGAGGGAGAGGG - Intronic
1172738844 20:37150266-37150288 AGACCGTGGAAAGCGGGAGACGG - Intronic
1172738855 20:37150306-37150328 AGACCGTGGAAAGTGGGAGACGG - Intronic
1172907049 20:38378117-38378139 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1172907061 20:38378152-38378174 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1173120234 20:40282381-40282403 GGCCCCTGGAAGGAGGCAGCTGG - Intergenic
1173210555 20:41028748-41028770 CGCTCGCGGAAAGAGGCAGAGGG - Intergenic
1173255708 20:41393161-41393183 GGGGGGTGGAAAGAGGGAGCTGG - Intergenic
1173273335 20:41556234-41556256 AGACCGTGGAAAGAGGGAGAGGG + Intronic
1173473168 20:43339045-43339067 AGACCGTGGAAAGCAGGAGAGGG + Intergenic
1173508614 20:43608154-43608176 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1173847677 20:46198379-46198401 GTCCCGGGGAGAGATGGAGAAGG - Intronic
1174344687 20:49921438-49921460 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1174579862 20:51563731-51563753 GGTCCGTGGGGAGGGGGAGAGGG + Intergenic
1174835649 20:53853762-53853784 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1174835671 20:53853829-53853851 AGACCGTGGAAAGAGAGGGAGGG - Intergenic
1175264447 20:57694059-57694081 GCCCCCAGGAAAGTGGGAGATGG - Intronic
1175758980 20:61548322-61548344 GGCAGGTGGAAGGAGGGAAAAGG + Intronic
1175776080 20:61654407-61654429 AGACCGTGGAAAGAGGGAGAGGG + Intronic
1175776088 20:61654430-61654452 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1176668317 21:9707985-9708007 GGGAGGTGGGAAGAGGGAGAGGG + Intergenic
1176991902 21:15507274-15507296 GGCCTGAGGACAGAGGAAGATGG + Intergenic
1177622712 21:23617421-23617443 GGCCCCTGGAAAAAGGAAGGTGG + Intergenic
1178034211 21:28563181-28563203 GGACCATGGGGAGAGGGAGAGGG - Intergenic
1178272092 21:31199977-31199999 GGCAAGTAGAGAGAGGGAGATGG - Intronic
1179070759 21:38068643-38068665 GGTCTGTGGGAAGAGGCAGAAGG + Intronic
1179126400 21:38595042-38595064 AGCCCGAGGCAAGAGGGAAATGG + Intronic
1179237908 21:39563599-39563621 GGAACGAGGAAGGAGGGAGAGGG - Intronic
1179968983 21:44824053-44824075 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1180039315 21:45267988-45268010 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1180739451 22:18042390-18042412 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1180861116 22:19083707-19083729 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1181296817 22:21847018-21847040 AGACCGTGGAAAGCGGGAGAAGG - Intronic
1181792487 22:25278629-25278651 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1182153442 22:28047622-28047644 GGCAAGGGGATAGAGGGAGACGG - Intronic
1182330969 22:29551799-29551821 AGACCGTGGAGAGAGGGGGAGGG - Intronic
1182335432 22:29580707-29580729 GGGCCCTGGAGAGTGGGAGAGGG - Intronic
1182484721 22:30632498-30632520 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1182935641 22:34219280-34219302 GTACCATGGAAACAGGGAGAGGG - Intergenic
1182982601 22:34685257-34685279 AGACCGTGGAAAGAGGGAGAGGG + Intergenic
1183455239 22:37918945-37918967 GGCCGTTGGAGGGAGGGAGAGGG + Intronic
1183595044 22:38806319-38806341 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1183597625 22:38822107-38822129 AGCTGGTGGAAAGAGGGAGGAGG + Exonic
1183633179 22:39045703-39045725 GGGCCCAGGAAAGAGGGAGGAGG - Intronic
1183869375 22:40729570-40729592 AGCCCATGTAAAGATGGAGATGG - Intergenic
1183930840 22:41235267-41235289 TGCCCGTGGCCAGAGGGTGAAGG - Exonic
1183940769 22:41294040-41294062 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1183963888 22:41429626-41429648 GGCCCCTGGAGAGAAGGAGTGGG + Intergenic
1184273566 22:43398175-43398197 GGCCCCTGGAAGGAGGGCCAAGG + Intergenic
1184376474 22:44116932-44116954 GCCCAGGGGCAAGAGGGAGATGG + Intronic
1184556489 22:45236019-45236041 GGCCAGAGGAGTGAGGGAGACGG - Intronic
1184663958 22:45977830-45977852 GGCCTGTGGAAGGAGGTTGAGGG + Intergenic
1184842883 22:47062984-47063006 GGAACATGGAAACAGGGAGAAGG + Intronic
1185412926 22:50695379-50695401 GGCCTGTGGTAAGGGGGACAGGG + Intergenic
949330583 3:2917278-2917300 AGACCGTGGAAAGCGGGAGGCGG + Intronic
949565804 3:5243487-5243509 AGACCGTGGGAAGAGGGAGAGGG + Intergenic
949565812 3:5243510-5243532 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
949570163 3:5284731-5284753 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
949853158 3:8439040-8439062 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
949988587 3:9559385-9559407 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
950412891 3:12850529-12850551 AGACCGTGGGGAGAGGGAGAGGG + Intronic
950565938 3:13769632-13769654 GGCCTGTGGAAAGGGAGAAAAGG - Intergenic
950634333 3:14304273-14304295 GGCCAAAGGAAAGAGCGAGAGGG - Intergenic
950709949 3:14806937-14806959 GGCCTGTGGGAATAGGGAGCTGG + Intergenic
950742224 3:15061206-15061228 AGACCGTGGGGAGAGGGAGACGG - Intronic
950742231 3:15061229-15061251 AGACCGTGGAAAGAGGGAGAGGG - Intronic
950932126 3:16800468-16800490 GACCTGTGGCAAGAGGGAGCCGG + Intergenic
951264373 3:20548745-20548767 AGACCGTAGAAAGCGGGAGACGG + Intergenic
951264379 3:20548776-20548798 AGACCGTGGAAAGCGGGAGACGG + Intergenic
951290654 3:20867797-20867819 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
953084714 3:39655271-39655293 AGACCGTGGAAAGCGGGAGGAGG - Intergenic
953084726 3:39655311-39655333 AGACCGTGGAAAGCGGGAGACGG - Intergenic
953257403 3:41305196-41305218 AGACCGTGGGGAGAGGGAGAGGG - Intronic
953257411 3:41305219-41305241 AGACCGTGGGGAGAGGGAGAGGG - Intronic
953373015 3:42406150-42406172 GCCCCCTTGAAAAAGGGAGAGGG + Intronic
953425831 3:42796972-42796994 AGACCGTGGGGAGAGGGAGACGG - Intronic
953440290 3:42910334-42910356 AGACCGTGCAAAGAGGGAGAGGG + Intronic
953771151 3:45779569-45779591 GCCCTGAGGAAAGCGGGAGAAGG + Intronic
953959343 3:47255731-47255753 AGACCGTGGGGAGAGGGAGAGGG - Intronic
954162563 3:48733495-48733517 AGACCGTGGGGAGAGGGAGAGGG - Intronic
954356439 3:50085855-50085877 AGACCGTGGGGAGAGGGAGAGGG + Intronic
954481518 3:50804746-50804768 AGACCGTGGGGAGAGGGAGAGGG + Intronic
954529949 3:51309591-51309613 AGACCGTGGGGAGAGGGAGAGGG + Intronic
955122555 3:56075309-56075331 GGGCAGAGGAAAGAGGGTGAGGG + Intronic
955363278 3:58291385-58291407 AGACCGTGGGGAGAGGGAGAGGG + Intronic
955435108 3:58891415-58891437 AGACCGTGGGGAGAGGGAGAGGG + Intronic
955626676 3:60926980-60927002 GCACCGTGGAAAGCGGGAGACGG - Intronic
955626688 3:60927018-60927040 AGACCGTGGAAAGTGGGAGACGG - Intronic
955670226 3:61394368-61394390 AGACCGTGCAAAGAGGGAGGGGG + Intergenic
957316967 3:78584291-78584313 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
960861839 3:122163716-122163738 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
960866258 3:122202473-122202495 AGACCGTGGGGAGAGGGAGAGGG + Intronic
960912708 3:122665288-122665310 CTCCCGTGGAAACCGGGAGATGG - Intergenic
961120939 3:124369051-124369073 AGACCGTGGGGAGAGGGAGAGGG + Intronic
961231646 3:125318014-125318036 GGCCCATGGAAAAAGGGAATAGG + Intronic
961324146 3:126100204-126100226 GGTACGTGGCAAGAGGGGGAGGG - Intronic
961456030 3:127024437-127024459 GGGCAGTGGAGGGAGGGAGAGGG + Intronic
961524295 3:127486745-127486767 GGCCAGTGGACTGAGGGGGAGGG + Intergenic
961729033 3:128953629-128953651 AGACCGTGGGGAGAGGGAGACGG - Intronic
961789293 3:129364346-129364368 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
962787790 3:138784443-138784465 AGACCGTGCAAAGTGGGAGACGG - Intronic
963249265 3:143087595-143087617 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
965136780 3:164783866-164783888 AGACCGTGGAAAGTGGGAGATGG - Intergenic
965136792 3:164783912-164783934 AGACCATGGAAAGTGGGAGATGG - Intergenic
966015702 3:175133729-175133751 AGACCGTGGGGAGAGGGAGAGGG + Intronic
966206844 3:177413663-177413685 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
966206853 3:177413686-177413708 AGACCGTGGGAAGAGGGGGAGGG + Intergenic
966420366 3:179728937-179728959 AGACCGTGGAGAGAGGGAGAGGG + Intronic
966617368 3:181926651-181926673 AGACCGTGGAAAGTGGGAGACGG + Intergenic
966734116 3:183175415-183175437 GACACGTGAAAAGTGGGAGATGG + Intergenic
967035640 3:185646696-185646718 GGCCTGAGGAGAGAGGGTGAGGG + Intronic
967109461 3:186280822-186280844 GCCCAGTGGGAAGAGGGACAGGG + Intronic
967127401 3:186436183-186436205 AGACGGTGCAAAGAGGGAGAGGG + Intergenic
967169553 3:186812438-186812460 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
967751770 3:193123328-193123350 GACCCTTGGAAAAAGGTAGAAGG + Intergenic
968084893 3:195869853-195869875 CGGCCGTGGAAGGAGGGAGGAGG + Intronic
968138766 3:196238782-196238804 GGCCATCGGAAAGAGGGGGAGGG + Exonic
968139281 3:196243522-196243544 AGACCGTGGGGAGAGGGAGAGGG - Intronic
968201998 3:196762668-196762690 AGACCGTGGGGAGAGGGAGAGGG + Intronic
968226078 3:196973238-196973260 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
968411481 4:394980-395002 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
968430025 4:551394-551416 AGACCGTGGAAAGAGGGAGAGGG + Intergenic
968438077 4:605648-605670 GGCCCAAGGAAAGGGAGAGAGGG - Intergenic
968665066 4:1816494-1816516 GGGCTGTGGGAAGAGGAAGAGGG + Intronic
968924467 4:3539691-3539713 AGACCGTGGAAAGAGGCAGAGGG + Intergenic
968924481 4:3539731-3539753 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
968945657 4:3662213-3662235 GGCGCGTGGAGAGAGGATGAGGG + Intergenic
969636960 4:8374876-8374898 GTCCCGTGGAAGGAGGACGATGG + Intronic
970216279 4:13762121-13762143 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
971595015 4:28515785-28515807 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
972551954 4:40142095-40142117 AGACCGTGGGGAGAGGGAGAGGG + Intronic
972938314 4:44167356-44167378 AGACCGTGGAAAGTGGGAGACGG - Intergenic
973108930 4:46376760-46376782 AGACCGTGGGGAGAGGGAGAGGG - Intronic
973108938 4:46376783-46376805 AGACCGTGGAGAGAGGGAGAGGG - Intronic
973221636 4:47732988-47733010 GGCCAGTGGAGAGATGGACATGG - Intronic
973593246 4:52464128-52464150 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
973675396 4:53256872-53256894 AGACCGTGGGGAGAGGGAGAGGG + Intronic
973717052 4:53687385-53687407 ATCTAGTGGAAAGAGGGAGAAGG - Intronic
974021386 4:56694295-56694317 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
974597713 4:64036664-64036686 AGACCGTGGAAAGCGGGAGAGGG - Intergenic
975796074 4:78007862-78007884 AGACCGTGGAAAGTGAGAGACGG + Intergenic
975908623 4:79244646-79244668 AGACCGTGGAAAGCGGGAGACGG - Intronic
976149256 4:82077104-82077126 AGACCGTGGGGAGAGGGAGATGG - Intergenic
976154467 4:82127686-82127708 GGCCTGAGGAAGGAGAGAGATGG - Intergenic
977542309 4:98331273-98331295 AGACCATGGAAAGCGGGAGACGG + Intronic
978408958 4:108408820-108408842 AGACCGTGGGAAGGGGGAGAGGG - Intergenic
978820433 4:112958601-112958623 AGACCGTGGGGAGAGGGAGAGGG + Intronic
978888574 4:113795930-113795952 AGACCATGGAAAGCGGGAGACGG - Intergenic
979622195 4:122811163-122811185 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
979641804 4:123017129-123017151 AGACCGTGGGGAGAGGGAGAGGG + Intronic
979702364 4:123684336-123684358 AGACCGTGGAAAGCCGGAGAGGG - Intergenic
980355210 4:131728094-131728116 GGGCGGCGGAAAGAGCGAGAGGG - Intergenic
981029535 4:140110330-140110352 GGCAAGTGGAAAGGGGGAAACGG + Intronic
981632326 4:146834527-146834549 GGGCCATTGAAAGAGGGAAAAGG - Intronic
981970250 4:150658761-150658783 AGACCGTGGGGAGAGGGAGAGGG - Intronic
982183033 4:152766102-152766124 AGACCGTGGAAAGTGGAAGACGG + Intronic
982821104 4:159940645-159940667 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
983613926 4:169679907-169679929 AGACCGTGGAAAGCGGGAGGTGG + Intronic
983702146 4:170610513-170610535 AGACAGTGGAAAGAGGGAAACGG + Intergenic
984233129 4:177124174-177124196 GGGAAGTGGAGAGAGGGAGAGGG - Intergenic
984728320 4:183041713-183041735 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
984977373 4:185241500-185241522 AGACCGTGGGGAGAGGGAGAGGG + Intronic
985168834 4:187126828-187126850 GCTAAGTGGAAAGAGGGAGAAGG - Intergenic
985247391 4:187991953-187991975 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
985247410 4:187992010-187992032 AGACCGTGGGGAGAGGGAGACGG + Intergenic
985406465 4:189643510-189643532 GGGAGGTGGGAAGAGGGAGAGGG - Intergenic
985668521 5:1194375-1194397 GGGCGGTGGGAGGAGGGAGAGGG - Intergenic
986822345 5:11481591-11481613 AGACCCTGGAGAGAGGGAGAGGG + Intronic
987257244 5:16168656-16168678 GCCCCATGGAAAGAAGGAGAAGG - Intronic
987268174 5:16277856-16277878 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
987469119 5:18308972-18308994 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
987502321 5:18729217-18729239 TGCCAGTTGAAAGAGGCAGAAGG - Intergenic
988544157 5:32141587-32141609 AGACCGTGGGGAGAGGGAGAGGG - Intronic
988760849 5:34307681-34307703 AGACCGTGGGGAGAGGGAGACGG + Intergenic
989068326 5:37484562-37484584 AGACCGTGGGGAGAGGGAGAGGG + Intronic
989076192 5:37564551-37564573 AGACCGTGGGGAGAGGGAGAGGG + Intronic
989211724 5:38863146-38863168 AGACCATGTAAAGAGGGAGAGGG + Intronic
989211732 5:38863169-38863191 AGACCGTGGGGAGAGGGAGAGGG + Intronic
989574591 5:42978710-42978732 AGACGGTGCAAAGAGGGAGAAGG - Intergenic
989633318 5:43510429-43510451 AGACCGTGGGGAGAGGGAGAGGG - Intronic
990498430 5:56371922-56371944 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
990709583 5:58565145-58565167 AGACTGTAGAAAGAGGGAGATGG + Intergenic
991228627 5:64303223-64303245 GGCCCAAGGAAAGGGAGAGATGG - Intronic
991373067 5:65939535-65939557 AGACCGTGGGGAGAGGGAGAGGG - Intronic
991672768 5:69063704-69063726 AGACCGTGGGGAGAGGGAGATGG + Intergenic
991672786 5:69063789-69063811 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
991672794 5:69063812-69063834 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
991723839 5:69516504-69516526 AGACCGTGGGGAGAGGGAGAGGG + Intronic
992078532 5:73213859-73213881 GGCTGGGGGAAAGATGGAGAGGG + Intergenic
992265693 5:75016156-75016178 GGTGGGTGGGAAGAGGGAGAGGG + Intergenic
992289389 5:75269408-75269430 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
992415972 5:76551836-76551858 AGACCTTGCAAAGAGGGAGACGG + Intronic
992442804 5:76811593-76811615 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
992574294 5:78096024-78096046 AGACCGTGGGGAGAGGGAGAGGG - Intronic
992801580 5:80300559-80300581 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
992964370 5:81984409-81984431 AGACCGTGGGGAGAGGGAGAGGG + Intronic
993496450 5:88615247-88615269 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
993496457 5:88615270-88615292 AGACTGTGGAGAGAGGGAGAGGG - Intergenic
993934504 5:93985377-93985399 AGACCATGGAAAGAGGGAGAGGG - Intronic
993934512 5:93985402-93985424 AGACCGTGGAAAGAGGGAGAGGG - Intronic
993934524 5:93985442-93985464 AGACCGTGGAAAGCGGGAGATGG - Intronic
994956105 5:106535163-106535185 GGAGGGTGGGAAGAGGGAGAGGG - Intergenic
995162025 5:108993563-108993585 AGACCGTGGGGAGAGGGAGAGGG + Intronic
995828403 5:116327606-116327628 GGCAGGGGGAGAGAGGGAGAGGG - Intronic
995942529 5:117600791-117600813 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
996070232 5:119123285-119123307 AGAGCGTGGAAAGAGGGAGAGGG + Intronic
996386450 5:122914117-122914139 AGACCGTGGGGAGAGGGAGAGGG + Intronic
996423317 5:123285769-123285791 GGCGTGGGGGAAGAGGGAGAGGG - Intergenic
998022038 5:138777865-138777887 AGACCGTGGGGAGAGGGAGAGGG + Intronic
998025471 5:138811926-138811948 AGACCGTGGGGAGAGGGAGAGGG + Intronic
998053456 5:139055636-139055658 AGACCGTGGGGAGAGGGAGAGGG - Intronic
998053464 5:139055659-139055681 AGACCGTGGGGAGAGGGAGAGGG - Intronic
998067263 5:139169832-139169854 AGACCGTGGGGAGAGGGAGAGGG - Intronic
998067271 5:139169855-139169877 AGACCGTGGAAAGAGGGAGAGGG - Intronic
998239659 5:140428643-140428665 AGACCGTGGGGAGAGGGAGAGGG + Intronic
999181305 5:149671403-149671425 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
999194818 5:149774730-149774752 GGCCAGAGGCAGGAGGGAGAGGG - Intronic
999260017 5:150232566-150232588 AGCCTGTGGAAGGAGGGAAAGGG - Intronic
999532824 5:152480817-152480839 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
999604367 5:153297821-153297843 GGACCTTGGGGAGAGGGAGAGGG + Intergenic
999949938 5:156637686-156637708 GGCCAGGGGAAAGGGGGAAATGG + Intronic
999978898 5:156939975-156939997 AGACCGTGGAAAGCGGGAGACGG - Intronic
999986817 5:157013473-157013495 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
999986827 5:157013502-157013524 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
999986837 5:157013531-157013553 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1000182560 5:158825982-158826004 GGCCCATGGTAGGAGGGAAAAGG + Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1002658396 5:180771764-180771786 AGACCGTGGAGAGAGGGAGACGG + Intergenic
1003407610 6:5836655-5836677 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1003844976 6:10163635-10163657 GGCCCTGGGAGACAGGGAGAGGG + Intronic
1004046080 6:12024924-12024946 GCCCAGTGGCAAGAGGGAGGTGG + Intronic
1004415166 6:15416695-15416717 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1004874172 6:19938677-19938699 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1005063769 6:21798378-21798400 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1005915744 6:30349247-30349269 GGGCTGTGGAAAGAGGAAGAGGG - Intergenic
1006014364 6:31068124-31068146 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1006014378 6:31068159-31068181 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1006169855 6:32086531-32086553 GGGCAGTGGGAAGAGAGAGAGGG + Intronic
1006225203 6:32531557-32531579 AGACCGTGCAAAGAGGGAGAGGG - Intergenic
1006282061 6:33060760-33060782 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1006282073 6:33060795-33060817 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1006370804 6:33642667-33642689 GGCCTGGGGGAGGAGGGAGAGGG - Intronic
1007651341 6:43424625-43424647 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1007651349 6:43424648-43424670 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1007849253 6:44788329-44788351 GGCTTGTGGAAAGGAGGAGATGG - Intergenic
1008098930 6:47370825-47370847 GGCCCCTTTAAAGGGGGAGAAGG - Intergenic
1008112376 6:47506773-47506795 AGACCGTGGGGAGAGGGAGACGG + Intronic
1008184507 6:48372068-48372090 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1009048915 6:58257112-58257134 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1009733708 6:67646434-67646456 GGCCTGAGGAGAGAGAGAGAGGG - Intergenic
1010192218 6:73206356-73206378 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1010400771 6:75442736-75442758 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1011087309 6:83556319-83556341 GGCAGGGGGAGAGAGGGAGAGGG + Intronic
1011148815 6:84245579-84245601 AGACCGTGGAAAGAGGGACAGGG + Intergenic
1011587910 6:88946668-88946690 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1012691277 6:102314567-102314589 GGAGGGTGGAAGGAGGGAGAGGG + Intergenic
1012899759 6:104991992-104992014 AGACCGTGGAAAGAGGGAGGGGG + Intronic
1012983876 6:105854902-105854924 GGGCCGTGGGGAGAGGGGGAGGG + Intergenic
1013190742 6:107802732-107802754 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1013231344 6:108164670-108164692 GTCCCGGGGAAAGAGCAAGATGG - Intronic
1013272829 6:108559490-108559512 GGCCCGGGAGAGGAGGGAGAAGG - Intergenic
1013325826 6:109046107-109046129 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1013637936 6:112047091-112047113 AGACCGTGGAAAGAGGGAGAGGG - Intergenic
1013681488 6:112529174-112529196 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1014123262 6:117750377-117750399 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1014463802 6:121730383-121730405 AGACAGTGCAAAGAGGGAGAGGG + Intergenic
1014463811 6:121730440-121730462 AGACCATGTAAAGAGGGAGAGGG + Intergenic
1014931583 6:127343091-127343113 CGGCCGGGGAAAGAGGGCGAGGG - Intronic
1016123802 6:140374690-140374712 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1016123810 6:140374713-140374735 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1016123818 6:140374736-140374758 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1016123826 6:140374759-140374781 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1016123836 6:140374788-140374810 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1016123847 6:140374823-140374845 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1016490851 6:144600130-144600152 GGCCCAAGGAAAGTGTGAGATGG - Intronic
1016802354 6:148179685-148179707 AGGCCGTGGAGAGAGGGAGAGGG + Intergenic
1016802362 6:148179708-148179730 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1016973777 6:149787296-149787318 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1017063326 6:150506981-150507003 AGACCGTGCAAAGACGGAGAGGG - Intergenic
1017851702 6:158309896-158309918 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1018528313 6:164737016-164737038 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1019061761 6:169262458-169262480 GGCCACTGGAAAGAGGGAGGTGG - Intergenic
1019282079 7:205675-205697 GGCCCCAGGCAGGAGGGAGATGG - Intronic
1019415618 7:925439-925461 GGCCGGAGGGAAGAGGGAGGAGG - Intronic
1020326186 7:6976118-6976140 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1021120593 7:16791050-16791072 AGACCGTGGAAAGAGGGGGGGGG + Intergenic
1021312182 7:19108626-19108648 GGCAGCTGGAAAGGGGGAGAGGG + Intronic
1021735143 7:23635883-23635905 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1021907990 7:25354823-25354845 GGCTCGGGGAAAGAGAGTGAAGG - Intergenic
1022005231 7:26261278-26261300 AGACCGTGGAAAGAGGGAGAGGG - Intergenic
1022542638 7:31153066-31153088 AGACAGTAGAAAGAGGGAGACGG - Intergenic
1023160408 7:37291936-37291958 AGACCGTGGGCAGAGGGAGAGGG - Intronic
1023954414 7:44872589-44872611 AGACTGTAGAAAGAGGGAGACGG + Intergenic
1024309664 7:47958793-47958815 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1024538521 7:50458945-50458967 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1024910546 7:54443492-54443514 AGACCGTAGAAAGAGGGAGGGGG - Intergenic
1024989378 7:55221161-55221183 AGACCGTGGGGAGAGGGAGACGG + Intronic
1025000414 7:55311210-55311232 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1025573171 7:62600656-62600678 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1025800661 7:64784124-64784146 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1025803835 7:64810429-64810451 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1025821818 7:64969094-64969116 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1025828809 7:65032927-65032949 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1026490004 7:70855030-70855052 GGCCCAAAGAAAGAGAGAGATGG + Intergenic
1026862257 7:73798089-73798111 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1026868040 7:73835212-73835234 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1027183118 7:75953301-75953323 AGACCGTGGAAAGAGGGAGGGGG + Intronic
1027514010 7:79118760-79118782 GGCCAGTGGAATCAGGGAGGAGG - Intronic
1027826643 7:83124733-83124755 AGACCGTGGAAAGCGGGAGATGG - Intronic
1027826655 7:83124773-83124795 AGACCCTGGAAAGCGGGAGAGGG - Intronic
1029279269 7:99426156-99426178 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1029279277 7:99426179-99426201 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1029279284 7:99426202-99426224 AGACTGTGGAAAGAGGGAGAGGG - Intronic
1029334766 7:99889233-99889255 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1029419135 7:100463322-100463344 GGGCTGGGGAAAGAGGGAGGGGG + Intronic
1029446358 7:100615059-100615081 GGCCCCAGGAAAAAGGGAGAAGG + Intronic
1029469142 7:100742838-100742860 AGACCGTGGGGAGAGGGAGACGG + Intronic
1029525541 7:101091770-101091792 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1029697164 7:102221073-102221095 GGCGGGTGGAAGGAGGGAGGAGG - Intronic
1030288141 7:107847566-107847588 AGACCGTGGAAAGAGGGAGAGGG - Intergenic
1030706501 7:112698035-112698057 AGACCGTGGGAAGAGGGAGAGGG + Intergenic
1032028498 7:128462882-128462904 AGACCGTGGAAAGCGGGAGACGG - Intergenic
1032043075 7:128577699-128577721 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1032157073 7:129477157-129477179 AGACCGTGGAAAGAGGGAGAGGG + Intronic
1032290901 7:130590198-130590220 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1032290915 7:130590244-130590266 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1032882315 7:136102902-136102924 GGCAGCTGGAATGAGGGAGAGGG + Intergenic
1034486911 7:151371510-151371532 GGCCTGTGGCAAGAGATAGAGGG + Intronic
1034723724 7:153316199-153316221 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1035479069 7:159167563-159167585 AGCCAGGGGAAGGAGGGAGAGGG - Intergenic
1036478659 8:9118174-9118196 GAGAAGTGGAAAGAGGGAGATGG - Intergenic
1036659712 8:10700108-10700130 GGCCCGTGGGCAGGGTGAGACGG + Intronic
1037469053 8:19189460-19189482 GTCCCGTGGAGAGGGGGAGGTGG - Intergenic
1037756430 8:21712989-21713011 AGACCGTGGAAAGAGGGAGAGGG + Intronic
1037770068 8:21793374-21793396 TGGGCGTGGACAGAGGGAGAGGG + Intronic
1037909343 8:22734359-22734381 AGCCCGTGGGAAGTGGAAGAAGG + Intronic
1038167801 8:25102447-25102469 AGACCGTGCAAAGAGGGGGAGGG - Intergenic
1039153572 8:34530217-34530239 GGGCCATGGGGAGAGGGAGAGGG + Intergenic
1039406868 8:37320537-37320559 GGCCAGTGCAAAGAAGGAGGAGG + Intergenic
1039488023 8:37927087-37927109 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1039563458 8:38531511-38531533 GGCCCTTGGGAAGAGGAAGGAGG + Intergenic
1039881364 8:41627273-41627295 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1040785307 8:51158405-51158427 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1041066112 8:54085014-54085036 AGACTGTGCAAAGAGGGAGAGGG - Intronic
1041287168 8:56272990-56273012 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1041921017 8:63180956-63180978 AGACCGTGGAAAGAGGGAGAGGG + Intronic
1044032297 8:87253285-87253307 AGCCCGGGGAGAGAGGGAGCAGG + Intronic
1044223517 8:89698165-89698187 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1044223525 8:89698188-89698210 AGACCGTGGAGAGAGGGAGAGGG - Intergenic
1044582396 8:93835237-93835259 AGACCGTAGAAAGAGGGAGACGG + Intergenic
1045022067 8:98052499-98052521 AGACCATGGAAAGCGGGAGAAGG + Intergenic
1045120616 8:99029771-99029793 AGACCGTGGAAAGAGGGAGAGGG + Intronic
1045195489 8:99926598-99926620 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1045195499 8:99926633-99926655 AGACCTTGGAAAGAGGGAGAGGG - Intergenic
1045341266 8:101256774-101256796 GGCCCGTGAATGAAGGGAGAGGG - Intergenic
1045406296 8:101869638-101869660 TGCCCGAGGCAAGAGGCAGATGG - Intronic
1046636097 8:116677990-116678012 AGACCGTGGGAAGGGGGAGAGGG - Intronic
1047306653 8:123658250-123658272 AGCCCGTGGAAAGCGGAACAAGG + Intergenic
1048317087 8:133370361-133370383 CGACCGTGGAAAGATAGAGATGG + Intergenic
1049177588 8:141203157-141203179 AGACCGTGGAGAGAGGGAGAGGG + Intergenic
1049177598 8:141203192-141203214 AGACCGTGGAGAGAGGGAGAGGG + Intergenic
1049177614 8:141203308-141203330 AGACCGTGGAGAGAGGGAGAGGG + Intergenic
1049481775 8:142827786-142827808 AGACCGTTGAAAGCGGGAGACGG + Intergenic
1049481786 8:142827826-142827848 AGACCGTGGAAAGCGGGAGATGG + Intergenic
1049915496 9:313602-313624 GGGCTGTGGGGAGAGGGAGAAGG + Intronic
1050417441 9:5432505-5432527 AGACCGTAGAAAGAGGGAGGGGG - Intronic
1050534760 9:6622272-6622294 GGCCCGTGGAAAGAGGGAGAGGG - Intronic
1050572038 9:6949843-6949865 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1050601717 9:7259619-7259641 GCTCCGTGGTAAGAAGGAGAAGG + Intergenic
1050862174 9:10449053-10449075 AGACCGTGGAAAGTGGGAGACGG - Intronic
1051276686 9:15405825-15405847 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1051430807 9:16978338-16978360 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1051807742 9:21014547-21014569 GGCTGAGGGAAAGAGGGAGAGGG + Intronic
1052236366 9:26215874-26215896 AGACCGTGGAAAGCGGGAGACGG + Intergenic
1052274658 9:26663636-26663658 AGACCGTGGAAAGCGGGAGACGG - Intergenic
1052274669 9:26663676-26663698 AGACCGTGGAAAGCGGGAGACGG - Intergenic
1052740600 9:32388718-32388740 GGGCAGTGGAATGAGGTAGAAGG + Intronic
1052887838 9:33667069-33667091 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1053047942 9:34936057-34936079 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1053467834 9:38324024-38324046 AGACCGTGGGGAGAGGGAGACGG - Intergenic
1054161481 9:61674601-61674623 GACTCGTGGAAAGAGGAACAGGG + Intergenic
1054359548 9:64100336-64100358 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1055137716 9:72842343-72842365 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1055501518 9:76906468-76906490 GGAAGGTGGGAAGAGGGAGACGG + Intergenic
1055506505 9:76954852-76954874 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1055519056 9:77061610-77061632 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1055585883 9:77760220-77760242 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1056229545 9:84528213-84528235 AGACCGTAGAAAGAGGGAGACGG + Intergenic
1056564583 9:87759901-87759923 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1056625048 9:88245967-88245989 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1056781356 9:89553554-89553576 GGGCAGTGCAAAGAAGGAGATGG - Intergenic
1057297328 9:93856734-93856756 GACCCCTGGTGAGAGGGAGAGGG - Intergenic
1057630656 9:96716497-96716519 AGACCATGGAAAGTGGGAGAGGG + Intergenic
1057838112 9:98463643-98463665 AGACTGTAGAAAGAGGGAGACGG - Intronic
1058018673 9:100067179-100067201 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1058244364 9:102604287-102604309 AGACCGTGGAAAGTGGGAGATGG + Intergenic
1058722342 9:107775380-107775402 AGACCGTGGGGAGAGGGAGACGG - Intergenic
1059530383 9:115030200-115030222 GGCCTAGGGGAAGAGGGAGAGGG - Intronic
1059676284 9:116543655-116543677 GGCCACTGGAGAGAGGGACAAGG - Intronic
1060036429 9:120259901-120259923 GGCCTGGGGAGAGAAGGAGATGG - Intergenic
1060243802 9:121926961-121926983 GCACGGTGGAAAGAGGGTGAAGG + Intronic
1060334642 9:122710777-122710799 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1060651298 9:125329105-125329127 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1060669964 9:125459847-125459869 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1060682159 9:125576490-125576512 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1060682167 9:125576513-125576535 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1060803281 9:126558016-126558038 GGCCAGTGGTTAGGGGGAGAAGG + Intergenic
1061223852 9:129268869-129268891 GACCAGTGGAATGTGGGAGAAGG + Intergenic
1061559428 9:131393700-131393722 GGCGCCCGGAAAGAGGGGGAAGG - Intergenic
1061635653 9:131907207-131907229 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1061772267 9:132934996-132935018 GGCCAGTGGTTAGAGGAAGATGG - Intronic
1062408314 9:136408691-136408713 AGGCGGTGGCAAGAGGGAGAAGG - Intronic
1203360549 Un_KI270442v1:217085-217107 GGCCTGTGGGGGGAGGGAGAAGG + Intergenic
1203657549 Un_KI270753v1:12970-12992 GGGAGGTGGGAAGAGGGAGAGGG - Intergenic
1186134922 X:6509036-6509058 GGAATGTGGAAAGAGGGAGAGGG + Intergenic
1186245311 X:7610280-7610302 AGACCGTGGAGAGAGGGAGAGGG + Intergenic
1186245317 X:7610303-7610325 AGACCGTGGAGAGAGGGAGAGGG + Intergenic
1187183874 X:16966117-16966139 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1188086258 X:25905270-25905292 AGACCGTGGAAAGTGGGAGACGG - Intergenic
1188156584 X:26749021-26749043 GGCCACTGCAAAGAGGGAGTAGG - Intergenic
1188294035 X:28423920-28423942 GGAGAGTGGAAGGAGGGAGAGGG + Intergenic
1188615219 X:32150032-32150054 GGTCTGTGTAAAGAGAGAGATGG - Intronic
1188734600 X:33696773-33696795 GGAAAATGGAAAGAGGGAGATGG + Intergenic
1189057035 X:37708213-37708235 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1189114295 X:38327355-38327377 TGCCCGTGGCATGAGGGAGCCGG - Exonic
1189271940 X:39758099-39758121 GGACTGTGGAAAGATGGAGCTGG - Intergenic
1189505692 X:41611687-41611709 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1189882302 X:45504856-45504878 AGACCGTGGAAAGCGGGAGATGG + Intergenic
1189882313 X:45504896-45504918 AGACCGTGGAAAGCGGGAGATGG + Intergenic
1189883366 X:45514297-45514319 GGCCCTTGGAAAGAGGGAGCAGG + Intergenic
1189968779 X:46397006-46397028 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1190184365 X:48221777-48221799 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1190681097 X:52827778-52827800 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1190839363 X:54130091-54130113 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1190839375 X:54130126-54130148 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1191009695 X:55747833-55747855 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1191009703 X:55747856-55747878 AGACCGTGGAAAGAGGGAGAGGG - Intronic
1191172133 X:57458980-57459002 CTCCCCTGGAAAGAGGGAAAGGG + Intronic
1191637190 X:63392423-63392445 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1192106320 X:68320951-68320973 GGCATGTGGAAAGAGGAACAGGG + Intronic
1192141012 X:68647353-68647375 GGCCTGTGGAAAGAGTGCCAAGG - Intergenic
1192194463 X:69019019-69019041 GGGCAGAGGAAGGAGGGAGAGGG + Intergenic
1192386639 X:70678956-70678978 AGACCGTGGGGAGAGGGAGAGGG - Intronic
1192386647 X:70678979-70679001 AGACCGTGGAGAGAGGGAGAGGG - Intronic
1192464257 X:71342548-71342570 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1192663480 X:73067340-73067362 AGACCGTAGAAAGAGGGAGAGGG - Intergenic
1192768354 X:74165724-74165746 AGACCGTGGAAAGAGGGAGAGGG - Intergenic
1192813680 X:74569817-74569839 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1192970072 X:76219192-76219214 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1193067889 X:77278674-77278696 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1193132591 X:77932912-77932934 GGACCGTGGGGAGAGGGAGAGGG + Intronic
1193164797 X:78266447-78266469 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1193328829 X:80214488-80214510 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1195257709 X:103105287-103105309 AGACCGTGGGGAGAGGGAGAGGG + Intergenic
1195687253 X:107598156-107598178 AGGGGGTGGAAAGAGGGAGAAGG - Intronic
1196778362 X:119361384-119361406 AGACCGTGGGGAGAGGGAGACGG - Intergenic
1197199135 X:123733518-123733540 AGACCGTGGGGAGAGGGAGACGG - Intergenic
1197735747 X:129849770-129849792 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1198108798 X:133484632-133484654 AGACTGTGCAAAGAGGGAGAGGG + Intergenic
1199083924 X:143607805-143607827 GGCCTGTTGTAATAGGGAGAAGG + Intergenic
1199230783 X:145435564-145435586 AGACCGTGGGGAGAGGGAGAGGG - Intergenic
1199452881 X:147993388-147993410 AGACCGTGGGGAGAGGGAGAGGG + Intronic
1199836924 X:151600284-151600306 AGACCGTGCAAAGAGGGAGACGG + Intronic
1199969663 X:152850245-152850267 GGCCTGTGGAAAGAGAGGAACGG - Exonic
1201440405 Y:14001579-14001601 AGACCGTGGAAAGCGGGAGAAGG + Intergenic
1201444166 Y:14041129-14041151 AGACCGTGGAAAGCGGGAGAAGG - Intergenic