ID: 1050535045 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:6623736-6623758 |
Sequence | CCTAAACTTTCAATGGAAGA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1050535045_1050535051 | 24 | Left | 1050535045 | 9:6623736-6623758 | CCTTCTTCCATTGAAAGTTTAGG | No data | ||
Right | 1050535051 | 9:6623783-6623805 | CACATCTGAGAAGATAGGCAAGG | 0: 1 1: 0 2: 2 3: 17 4: 233 |
||||
1050535045_1050535048 | 19 | Left | 1050535045 | 9:6623736-6623758 | CCTTCTTCCATTGAAAGTTTAGG | No data | ||
Right | 1050535048 | 9:6623778-6623800 | AAACCCACATCTGAGAAGATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1050535045 | Original CRISPR | CCTAAACTTTCAATGGAAGA AGG (reversed) | Intronic | ||