ID: 1050535047 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:6623743-6623765 |
| Sequence | CTTATTTCCTAAACTTTCAA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1050535047_1050535051 | 17 | Left | 1050535047 | 9:6623743-6623765 | CCATTGAAAGTTTAGGAAATAAG | No data | ||
| Right | 1050535051 | 9:6623783-6623805 | CACATCTGAGAAGATAGGCAAGG | 0: 1 1: 0 2: 2 3: 17 4: 233 |
||||
| 1050535047_1050535048 | 12 | Left | 1050535047 | 9:6623743-6623765 | CCATTGAAAGTTTAGGAAATAAG | No data | ||
| Right | 1050535048 | 9:6623778-6623800 | AAACCCACATCTGAGAAGATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1050535047 | Original CRISPR | CTTATTTCCTAAACTTTCAA TGG (reversed) | Intronic | ||