ID: 1050535047

View in Genome Browser
Species Human (GRCh38)
Location 9:6623743-6623765
Sequence CTTATTTCCTAAACTTTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050535047_1050535048 12 Left 1050535047 9:6623743-6623765 CCATTGAAAGTTTAGGAAATAAG No data
Right 1050535048 9:6623778-6623800 AAACCCACATCTGAGAAGATAGG No data
1050535047_1050535051 17 Left 1050535047 9:6623743-6623765 CCATTGAAAGTTTAGGAAATAAG No data
Right 1050535051 9:6623783-6623805 CACATCTGAGAAGATAGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050535047 Original CRISPR CTTATTTCCTAAACTTTCAA TGG (reversed) Intronic