ID: 1050535048

View in Genome Browser
Species Human (GRCh38)
Location 9:6623778-6623800
Sequence AAACCCACATCTGAGAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050535045_1050535048 19 Left 1050535045 9:6623736-6623758 CCTTCTTCCATTGAAAGTTTAGG No data
Right 1050535048 9:6623778-6623800 AAACCCACATCTGAGAAGATAGG No data
1050535047_1050535048 12 Left 1050535047 9:6623743-6623765 CCATTGAAAGTTTAGGAAATAAG No data
Right 1050535048 9:6623778-6623800 AAACCCACATCTGAGAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050535048 Original CRISPR AAACCCACATCTGAGAAGAT AGG Intronic