ID: 1050538384

View in Genome Browser
Species Human (GRCh38)
Location 9:6649376-6649398
Sequence GAATTGCAACTGATGTCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050538376_1050538384 17 Left 1050538376 9:6649336-6649358 CCCAGCTTCAAGCTGATCCGTCA No data
Right 1050538384 9:6649376-6649398 GAATTGCAACTGATGTCTTGGGG No data
1050538380_1050538384 0 Left 1050538380 9:6649353-6649375 CCGTCAGAAGTTCTGGAGGCCTA No data
Right 1050538384 9:6649376-6649398 GAATTGCAACTGATGTCTTGGGG No data
1050538377_1050538384 16 Left 1050538377 9:6649337-6649359 CCAGCTTCAAGCTGATCCGTCAG No data
Right 1050538384 9:6649376-6649398 GAATTGCAACTGATGTCTTGGGG No data
1050538375_1050538384 18 Left 1050538375 9:6649335-6649357 CCCCAGCTTCAAGCTGATCCGTC No data
Right 1050538384 9:6649376-6649398 GAATTGCAACTGATGTCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050538384 Original CRISPR GAATTGCAACTGATGTCTTG GGG Intergenic
No off target data available for this crispr